MirGeneDB

MirGeneDB ID

Cgi-Mir-9-P12

Family name MIR-9 (all species)
Seed CUUUGGU
Species Pacific oyster (Crassostrea gigas)
MiRBase ID
Paralogues Cgi-Mir-9-P13  Cgi-Mir-9-P14 
Orthologues Bge-Mir-9-o12-v1  Bge-Mir-9-o12-v2  Cin-Mir-9  Cte-Mir-9  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) C. gigas
Node of Origin (family) Bilateria
Genome context
(CGI_GCA_000297895.1)
scaffold42448: 83582-83643 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CACGUGACCAAGAUGGCGUUGCUAGUUUUGUCUUUGGUUAUCUAGCUGUAUGAUUUCAUUUAAUAUUUCAUAAAGCUAGGUUACCAAAGGCAAAAAUGGCUGUCGAUCCCUGCGUUUGACCA
Get precursor sequence
Structure
        10        20          30        40        50        60
CACGUGACCAAGAUGGCGUU--|   G             U        G     UUUCAU 
                      GCUA UUUUGUCUUUGGU AUCUAGCU UAUGA      U
                      CGGU AAAACGGAAACCA UGGAUCGA AUACU      U
ACCAGUUUGCGUCCCUAGCUGU^   A             U        A     UUAUAA 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
CommentThere is a second Dicer site -1 relative to what is annotated here.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
A- D- D- Eg F- Gi He Ju L- Ma Ma Pe Re Sp Um Ea Fe Ha La Ma
Mature sequence

Cgi-Mir-9-P12_5p

MirBase accessionNone
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Star sequence

Cgi-Mir-9-P12_3p*

MirBase accessionNone
Sequence
39- AUAAAGCUAGGUUACCAAAGGCA -62
Get sequence