MirGeneDB

MirGeneDB ID

Cgi-Mir-67-P4

Family name MIR-67 (all species)
Seed CACAACC
Species Pacific oyster (Crassostrea gigas)
MiRBase ID
Paralogues Cgi-Mir-67-P5  Cgi-Mir-67-P6 
Orthologues Aae-Mir-67  Asu-Mir-67  Bge-Mir-67  Cbr-Mir-67  Cel-Mir-67  Cte-Mir-67  Dan-Mir-67  Dme-Mir-67  Dmo-Mir-67  Dpu-Mir-67  Hme-Mir-67  Isc-Mir-67  Lan-Mir-67  Lgi-Mir-67 
Node of Origin (locus) C. gigas
Node of Origin (family) Protostomia
Genome context
(CGI_GCA_000297895.1)
scaffold146: 102638-102698 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CCUCCUGUAGGAAUUUGGUUUUGUACAGAUCCUUAUUCAACCUGGUUGUGGUGCCCAAUAAACCAUCAUCACAACCUCCUUGAAUGAGUGUUCUUGCAGACCACCACCGCAAUAUCAACCC
Get precursor sequence
Structure
        10          20        30        40        50          
CCUCCUGUAGGAAUUUGGU--|     CA  UC         CCU          CCCAAU 
                     UUUGUA  GA  CUUAUUCAA   GGUUGUGGUG      \
                     AGACGU  UU  GAGUAAGUU   CCAACACUAC      A
CCCAACUAUAACGCCACCACC^     UC  GU         CCU          UACCAA 
 .       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
A- D- D- Eg F- Gi He Ju L- Ma Ma Pe Re Sp Um Ea Fe Ha La Ma
Star sequence

Cgi-Mir-67-P4_5p*

MirBase accessionNone
Sequence
0- CCUUAUUCAACCUGGUUGUGGUG -23
Get sequence
Mature sequence

Cgi-Mir-67-P4_3p

MirBase accessionNone
Sequence
38- UCACAACCUCCUUGAAUGAGUGU -61
Get sequence