MirGeneDB

MirGeneDB ID

Cgi-Mir-184-P15k

Family name MIR-184 (all species)
Seed GGACGGA
Species Pacific oyster (Crassostrea gigas)
MiRBase ID
Paralogues Cgi-Mir-184-P7  Cgi-Mir-184-P8a  Cgi-Mir-184-P8b  Cgi-Mir-184-P8c  Cgi-Mir-184-P8d  Cgi-Mir-184-P9  Cgi-Mir-184-P10  Cgi-Mir-184-P11  Cgi-Mir-184-P12  Cgi-Mir-184-P13a  Cgi-Mir-184-P13b  Cgi-Mir-184-P14  Cgi-Mir-184-P15a1  Cgi-Mir-184-P15a2  Cgi-Mir-184-P15a3  Cgi-Mir-184-P15a4  Cgi-Mir-184-P15a5  Cgi-Mir-184-P15a6  Cgi-Mir-184-P15a7  Cgi-Mir-184-P15b  Cgi-Mir-184-P15c  Cgi-Mir-184-P15d  Cgi-Mir-184-P15e1  Cgi-Mir-184-P15e2  Cgi-Mir-184-P15e3  Cgi-Mir-184-P15f  Cgi-Mir-184-P15g1  Cgi-Mir-184-P15g2  Cgi-Mir-184-P15g3  Cgi-Mir-184-P15h  Cgi-Mir-184-P15i  Cgi-Mir-184-P15j  Cgi-Mir-184-P15l1  Cgi-Mir-184-P15l2  Cgi-Mir-184-P15m  Cgi-Mir-184-P15n  Cgi-Mir-184-P15o  Cgi-Mir-184-P15p  Cgi-Mir-184-P15q  Cgi-Mir-184-P15r  Cgi-Mir-184-P15s  Cgi-Mir-184-P15t  Cgi-Mir-184-P15u 
Orthologues Aae-Mir-184  Aca-Mir-184  Ami-Mir-184  Asu-Mir-184  Bfl-Mir-184  Bge-Mir-184  Bta-Mir-184  Cfa-Mir-184  Cin-Mir-184  Cli-Mir-184  Cpi-Mir-184  Cpo-Mir-184  Dan-Mir-184  Dme-Mir-184  Dmo-Mir-184  Dno-Mir-184  Dpu-Mir-184  Ete-Mir-184  Gga-Mir-184  Hme-Mir-184  Hsa-Mir-184  Isc-Mir-184  Lan-Mir-184  Mdo-Mir-184  Mml-Mir-184  Mmu-Mir-184  Oan-Mir-184  Ocu-Mir-184  Pfl-Mir-184  Pmi-Mir-184  Rno-Mir-184  Sha-Mir-184  Sko-Mir-184  Spu-Mir-184  Sto-Mir-184  Tca-Mir-184  Tgu-Mir-184  Xtr-Mir-184 
Node of Origin (locus) C. gigas
Node of Origin (family) Bilateria
Genome context
(CGI_GCA_000297895.1)
scaffold121: 721469-721526 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
CACAGAUAACAAAUACAACUUGUUGCGUUUCCUUGUCACUCAUUCGUCACAGUGACAUUUAAACACUGGACGGAAGUCUGAUAAGGGAUCGCCAAGGGAACUUCUUCAUUAUGUAAUC
Get precursor sequence
Structure
        10            20        30        40        50         
CACAGAUAACAAAUACAA----|   UU   U          CUCA      A    GACAU 
                      CUUG  GCG UUCCUUGUCA    UUCGUC CAGU     \
                      GAAC  CGC AGGGAAUAGU    AGGCAG GUCA     U
CUAAUGUAUUACUUCUUCAAGG^   --   U          CUGA      -    CAAAU 
      110       100          90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
A- D- D- Eg F- Gi He Ju L- Ma Ma Pe Re Sp Um Ea Fe Ha La Ma
Star sequence

Cgi-Mir-184-P15k_5p* (predicted)

MirBase accessionNone
Sequence
0- CCUUGUCACUCAUUCGUCACAGU -23
Get sequence
Mature sequence

Cgi-Mir-184-P15k_3p

MirBase accessionNone
Sequence
36- UGGACGGAAGUCUGAUAAGGGA -58
Get sequence