MirGeneDB

MirGeneDB ID

Cgi-Mir-124-P12

Family name MIR-124 (all species)
Seed AAGGCAC
Species Pacific oyster (Crassostrea gigas)
MiRBase ID
Paralogues Cgi-Mir-124-P13 
Orthologues Aae-Mir-124  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Cel-Mir-124  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dpu-Mir-124  Hme-Mir-124  Isc-Mir-124  Lan-Mir-124  Pfl-Mir-124  Pmi-Mir-124  Sko-Mir-124  Spu-Mir-124  Tca-Mir-124 
Node of Origin (locus) C. gigas
Node of Origin (family) Bilateria
Genome context
(CGI_GCA_000297895.1)
scaffold427: 142710-142766 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GAAACAAAGACGAUGAAUUCUUACCUGUUCGUGUUCACCGGGUAGACCUUGAUGGUAUAGAACAAUUAAGGCACGCGGUGAAUGCCAAGGGGGAGAAAAUAUCUUCAUGAAGCCAAA
Get precursor sequence
Structure
        10           20        30        40        50         
GAAACAAAGACGAUGAA---|    A   G  C          G  AGA       GGUAU 
                    UUCUU CCU UU GUGUUCACCG GU   CCUUGAU     \
                    AAGAG GGG AA CGUAAGUGGC CA   GGAAUUA     A
AAACCGAAGUACUUCUAUAA^    -   G  C          G  C--       ACAAG 
     110       100         90        80          70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
A- D- D- Eg F- Gi He Ju L- Ma Ma Pe Re Sp Um Ea Fe Ha La Ma
Star sequence

Cgi-Mir-124-P12_5p*

MirBase accessionNone
Sequence
0- GUGUUCACCGGGUAGACCUUGAU -23
Get sequence
Mature sequence

Cgi-Mir-124-P12_3p

MirBase accessionNone
Sequence
36- UAAGGCACGCGGUGAAUGCCA -57
Get sequence