MirGeneDB

MirGeneDB ID

Cfa-Mir-27-P1

Family name MIR-27 (all species)
Seed UCACAGU
Species Dog (Canis familiaris)
MiRBase ID cfa-mir-27a
Paralogues Cfa-Mir-27-P2 
Orthologues Aca-Mir-27-P1  Ami-Mir-27-P1  Bta-Mir-27-P1  Cpi-Mir-27-P1  Cpo-Mir-27-P1  Dno-Mir-27-P1  Dre-Mir-27-P1  Ete-Mir-27-P1  Hsa-Mir-27-P1  Mdo-Mir-27-P1  Mml-Mir-27-P1  Mmu-Mir-27-P1  Oan-Mir-27-P1  Rno-Mir-27-P1  Sha-Mir-27-P1  Sto-Mir-27-o1  Sto-Mir-27-P1  Tgu-Mir-27-P1  Xtr-Mir-27-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(canFam3)
chr20: 48620555-48620616 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-27-P1)
Mir-23-P1 chr20: 48620332-48620389 [+] UCSC Ensembl
Mir-27-P1 chr20: 48620555-48620616 [+] UCSC Ensembl
Mir-24-P1 chr20: 48620685-48620744 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCCCUGCUGUCUUCGUCUGGCCUGGGGAGCAGGGCUUAGCUGCUUGUGAGCAGAGUCCACACCAAGUCGUGUUCACAGUGGCUAAGUUCCGCCCCCCGGGACCCCGCCUCCUCUGGCUCUGC
Get precursor sequence
Structure
        10         20         30        40        50        60 
CCCCUGCUGUCUUCGUCU-  -|      A  A         UG  U       GAGUCCAC 
                   GG CCUGGGG GC GGGCUUAGC  CU GUGAGCA        \
                   CC GGGCCCC CG CUUGAAUCG  GA CACUUGU        A
CGUCUCGGUCUCCUCCGCC  A^      C  C         GU  -       GCUGAACC 
120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bl Ce Co He Hy Ki Ki Li Lu Ov Sk Te Te
Star sequence

Cfa-Mir-27-P1_5p*

MirBase accessionNone
Sequence
0- AGGGCUUAGCUGCUUGUGAGCA -22
Get sequence
Mature sequence

Cfa-Mir-27-P1_3p

MirBase accessionMIMAT0006641
Sequence
41- UUCACAGUGGCUAAGUUCCGC -62
Get sequence
Validated targets TargetScanVert: cfa-miR-27a
miRDB: MIMAT0006641