MirGeneDB

MirGeneDB ID

Cfa-Mir-24-P1

Family name MIR-24 (all species)
Seed GGCUCAG
Species Dog (Canis familiaris)
MiRBase ID cfa-mir-24-2
Paralogues Cfa-Mir-24-P2 
Orthologues Aca-Mir-24-P1  Ami-Mir-24-P1  Bta-Mir-24-P1  Cpi-Mir-24-P1  Cpo-Mir-24-P1  Dno-Mir-24-P1  Dre-Mir-24-P1  Ete-Mir-24-P1  Hsa-Mir-24-P1  Mdo-Mir-24-P1  Mml-Mir-24-P1  Mmu-Mir-24-P1  Oan-Mir-24-P1  Ocu-Mir-24-P1  Rno-Mir-24-P1  Sha-Mir-24-P1  Sto-Mir-24-o1  Sto-Mir-24-P1  Xtr-Mir-24-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(canFam3)
chr20: 48620685-48620744 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-24-P1)
Mir-23-P1 chr20: 48620332-48620389 [+] UCSC Ensembl
Mir-27-P1 chr20: 48620555-48620616 [+] UCSC Ensembl
Mir-24-P1 chr20: 48620685-48620744 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CUGUCUGGGCCUCCCUGGGCUCUGCCUCCCGUGCCUACUGAGCUGAAACACAGUUGAUUUGUGCAGACUGGCUCAGUUCAGCAGGAACAGGAGUCGAGCCCCCUCGGAGCCUGUGGCGCC
Get precursor sequence
Structure
        10           20        30        40        50        60
CUGUCUGGGCCUCCCUG---|    U C    C  G   A         AACA    UGAUU 
                    GGCUC G CUCC GU CCU CUGAGCUGA    CAGU     U
                    CCGAG C GAGG CA GGA GACUUGACU    GUCA     G
CCGCGGUGUCCGAGGCUCCC^    - U    A  A   C         CG--    GACGU 
.       110       100         90        80          70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
Bl Ce Co He Hy Ki Ki Li Lu Ov Sk Te Te
Star sequence

Cfa-Mir-24-P1_5p*

MirBase accessionNone
Sequence
0- GUGCCUACUGAGCUGAAACACAGU -24
Get sequence
Mature sequence

Cfa-Mir-24-P1_3p

MirBase accessionMIMAT0006614
Sequence
38- UGGCUCAGUUCAGCAGGAACAG -60
Get sequence
Validated targets TargetScanVert: cfa-miR-24
miRDB: MIMAT0006614