MirGeneDB

MirGeneDB ID

Cfa-Mir-205-P1

Family name MIR-205 (all species)
Seed CCUUCAU
Species Dog (Canis familiaris)
MiRBase ID cfa-mir-205
Paralogues
Orthologues Aca-Mir-205-P1  Ami-Mir-205-P1  Bta-Mir-205-P1  Cli-Mir-205-P1  Cpi-Mir-205-P1  Cpo-Mir-205-P1  Dno-Mir-205-P1  Dre-Mir-205-P1  Ete-Mir-205-P1  Gga-Mir-205-P1  Hsa-Mir-205-P1  Mdo-Mir-205-P1  Mml-Mir-205-P1  Mmu-Mir-205-P1  Oan-Mir-205-P1  Ocu-Mir-205-P1  Rno-Mir-205-P1  Sha-Mir-205-P1  Sto-Mir-205-P1  Tgu-Mir-205-P1a  Tgu-Mir-205-P1b  Xtr-Mir-205-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(canFam3)
chr7: 8090517-8090575 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGCCCCAGACAAUCCAUGUGUUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCGUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCGUGGACCUGACACCGCAGCGGCCG
Get precursor sequence
Structure
        10        20          30        40        50         
GAGCCCCAGACAAUCCAUGUGUU--|      UC           C        UCUCGU 
                         UCUCUUG  CUUCAUUCCAC GGAGUCUG      \
                         GGAGGAC  GAAGUGAGGUG CUUUAGAC      A
GCCGGCGACGCCACAGUCCAGGUGC^      UU           A        CAACCC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bl Ce Co He Hy Ki Ki Li Lu Ov Sk Te Te
Mature sequence

Cfa-Mir-205-P1_5p

MirBase accessionMIMAT0009845
Sequence
0- UCCUUCAUUCCACCGGAGUCUG -22
Get sequence
Validated targets TargetScanVert: cfa-miR-205
miRDB: MIMAT0009845
Star sequence

Cfa-Mir-205-P1_3p*

MirBase accessionNone
Sequence
37- GAUUUCAGUGGAGUGAAGUUCA -59
Get sequence