MirGeneDB

MirGeneDB ID

Cfa-Mir-19-P2b

Family name MIR-19 (all species)
Seed GUGCAAA
Species Dog (Canis familiaris)
MiRBase ID cfa-mir-19b-2
Paralogues Cfa-Mir-19-P1  Cfa-Mir-19-P2a 
Orthologues Aca-Mir-19-P2b  Bta-Mir-19-P2b  Cli-Mir-19-P2b  Cpi-Mir-19-P2b  Cpo-Mir-19-P2b  Dno-Mir-19-P2b  Dre-Mir-19-P2b1  Ete-Mir-19-P2b  Gga-Mir-19-P2b  Hsa-Mir-19-P2b  Mdo-Mir-19-P2b  Mml-Mir-19-P2b  Mmu-Mir-19-P2b  Oan-Mir-19-P2b  Ocu-Mir-19-P2b  Rno-Mir-19-P2b  Sha-Mir-19-P2b  Sto-Mir-19-P2b  Tgu-Mir-19-P2b  Xtr-Mir-19-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(canFam3)
chrX: 104895961-104896026 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-19-P2b)
Mir-92-P2b chrX: 104895658-104895722 [-] UCSC Ensembl
Mir-92-P1b chrX: 104895826-104895886 [-] UCSC Ensembl
Mir-19-P2b chrX: 104895961-104896026 [-] UCSC Ensembl
Mir-17-P3b chrX: 104896094-104896154 [-] UCSC Ensembl
Mir-17-P2b chrX: 104896344-104896408 [-] UCSC Ensembl
Mir-17-P1b chrX: 104896517-104896575 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGUUGGUGAAAUACCCUGCCGCUUCCGGUUAGUUUUGCAGGUUUGCAUUUCAGCGUACUUGUGCAUAUAGGGCUGUGCAAAUCCAUGCAAAACUGACCGUGAUCAUGUGUGUGCCGUCGGUGGCUC
Get precursor sequence
Structure
        10         20         30         40         50        60   
UGUUGGUGAAAUACCCU-  CGCU  -              -  -|     UUU    GUACUUGU 
                  GC    UC CGGUUAGUUUUGCA GG UUUGCA   CAGC        \
                  UG    AG GCCAGUCAAAACGU CC AAACGU   GUCG        G
CUCGGUGGCUGCCGUGUG  UACU  U              A  U^     ---    GGAUAUAC 
    120       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Bl Ce Co He Hy Ki Ki Li Lu Ov Sk Te Te
Star sequence

Cfa-Mir-19-P2b_5p*

MirBase accessionNone
Sequence
0- AGUUUUGCAGGUUUGCAUUUCAGC -24
Get sequence
Mature sequence

Cfa-Mir-19-P2b_3p

MirBase accessionMIMAT0006652
Sequence
43- UGUGCAAAUCCAUGCAAAACUGA -66
Get sequence
Validated targets TargetScanVert: cfa-miR-19b
miRDB: MIMAT0006652