MirGeneDB

MirGeneDB ID

Cfa-Mir-135-P3

Family name MIR-135 (all species)
Seed AUGGCUU
Species Dog (Canis familiaris)
MiRBase ID cfa-mir-135b
Paralogues Cfa-Mir-135-P1  Cfa-Mir-135-P2 
Orthologues Aca-Mir-135-P3  Ami-Mir-135-P3  Bta-Mir-135-P3  Cli-Mir-135-P3  Cpi-Mir-135-P3  Cpo-Mir-135-P3  Dno-Mir-135-P3  Dre-Mir-135-P3a  Dre-Mir-135-P3b  Ete-Mir-135-P3  Gga-Mir-135-P3  Hsa-Mir-135-P3  Mdo-Mir-135-P3  Mml-Mir-135-P3  Mmu-Mir-135-P3  Oan-Mir-135-P3  Ocu-Mir-135-P3  Rno-Mir-135-P3  Sha-Mir-135-P3  Sto-Mir-135-P3  Tgu-Mir-135-P3  Xtr-Mir-135-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Chordata
Genome context
(canFam3)
chr38: 1926572-1926632 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCGCUGGACCCCCUCAGCUCUGCUGUGGCCUAUGGCUUUUCAUUCCUAUGUGAUUGCUGUUUCUAAUUCAUGUAGGGCUAAAAGCCAUGGGCUACAGUGAGGGGCGUGCUCCUUCUCCUGA
Get precursor sequence
Structure
        10         20         30        40        50        60
CCGCUGGACCCCCUCAG-    -|                  CAU          UUGCUG 
                  CUCU GCUGUGGCCUAUGGCUUUU   UCCUAUGUGA      U
                  GGGA UGACAUCGGGUACCGAAAA   GGGAUGUACU      U
AGUCCUCUUCCUCGUGCG    G^                  UC-          UAAUCU 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Bl Ce Co He Hy Ki Ki Li Lu Ov Sk Te Te
Mature sequence

Cfa-Mir-135-P3_5p

MirBase accessionMIMAT0009839
Sequence
0- UAUGGCUUUUCAUUCCUAUGUGA -23
Get sequence
Validated targets TargetScanVert: cfa-miR-135b
miRDB: MIMAT0009839
Star sequence

Cfa-Mir-135-P3_3p*

MirBase accessionNone
Sequence
39- AUGUAGGGCUAAAAGCCAUGGG -61
Get sequence