MirGeneDB

MirGeneDB ID

Cel-Mir-9-P19

Family name MIR-9 (all species)
Seed CUUUGGU
Species Roundworm (Caenorhabditis elegans)
MiRBase ID cel-mir-244
Paralogues Cel-Mir-9-P17  Cel-Mir-9-P18 
Orthologues Cbr-Mir-9-P19  Cin-Mir-9  Cte-Mir-9  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) Caenorhabditis
Node of Origin (family) Bilateria
Genome context
(ce11)
chrI: 4684336-4684399 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUUUUAAUUUUUUCCCUCCAUAUCUCAAUCUCUUUGGUUGUACAAAGUGGUAUGGCUCAUCGAAUAAGCACAUACUGCUUUUCAGCUAAAGGAAUUGAGAUUUUGUAGGCUUUUUCAUUUUUAC
Get precursor sequence
Structure
        10         20         30        40        50        60  
AUUUUAAUUUUUUCCCUC-  U-|       CU         UAC    UG     GCUCAUC 
                   CA  AUCUCAAU  CUUUGGUUG   AAAG  GUAUG       G
                   GU  UAGAGUUA  GAAAUCGAC   UUUC  CAUAC       A
CAUUUUUACUUUUUCGGAU  UU^       AG         U--    GU     ACGAAUA 
  120       110       100        90          80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Wt Da Ea Mi Yo Yo
Mature sequence

Cel-Mir-9-P19_5p

MirBase accessionMIMAT0000300
Sequence
0- UCUUUGGUUGUACAAAGUGGUAUG -24
Get sequence
Validated targets microrna.org: MIMAT0000300
TargetScanWorm: cel-miR-244
Star sequence

Cel-Mir-9-P19_3p*

MirBase accessionMIMAT0015118
Sequence
42- UACUGCUUUUCAGCUAAAGGAA -64
Get sequence
Validated targets microrna.org: MIMAT0015118