MirGeneDB

MirGeneDB ID

Cel-Mir-9-P18

Family name MIR-9 (all species)
Seed UAAAGCU
Species Roundworm (Caenorhabditis elegans)
MiRBase ID cel-mir-79
Paralogues Cel-Mir-9-P17  Cel-Mir-9-P19 
Orthologues Asu-Mir-9-o18-v1  Asu-Mir-9-o18-v2  Cbr-Mir-9-P18  Cin-Mir-9  Cte-Mir-9  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) Caenorhabditis
Node of Origin (family) Bilateria
Genome context
(ce11)
chrI: 9332964-9333027 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GUAAGUUGAAAUUAGUAGACAUUCUCCGAUCUUUGGUGAUUCAGCUUCAAUGAUUGGCUACAGGUUUCUUUCAUAAAGCUAGGUUACCAAAGCUCGGCGUCUUGAUCUACAGUUCUUUUUUUUU
Get precursor sequence
Structure
        10              20        30        40        50        60  
GUAAGUUGAAAUUAGUA------|  AUUCU    U          UC     CA    UUGGCUAC 
                       GAC     CCGA CUUUGGUGAU  AGCUU  AUGA        \
                       CUG     GGCU GAAACCAUUG  UCGAA  UACU        A
UUUUUUUUUCUUGACAUCUAGUU^  C----    C          GA     A-    UUCUUUGG 
  120       110       100            90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
Wt Da Ea Mi Yo Yo
Star sequence

Cel-Mir-9-P18_5p*

MirBase accessionMIMAT0020322
Sequence
0- CUUUGGUGAUUCAGCUUCAAUGA -23
Get sequence
Mature sequence

Cel-Mir-9-P18_3p

MirBase accessionMIMAT0000051
Sequence
42- AUAAAGCUAGGUUACCAAAGCU -64
Get sequence
Validated targets microrna.org: MIMAT0000051
TargetScanWorm: cel-miR-79