MirGeneDB

MirGeneDB ID

Cbr-Mir-9-P18

Family name MIR-9 (all species)
Seed UAAAGCU
Species Roundworm (Caenorhabditis briggsae)
MiRBase ID cbr-mir-79
Paralogues Cbr-Mir-9-P17  Cbr-Mir-9-P19 
Orthologues Asu-Mir-9-o18-v1  Asu-Mir-9-o18-v2  Cel-Mir-9-P18  Cin-Mir-9  Cte-Mir-9  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) Caenorhabditis
Node of Origin (family) Bilateria
Genome context
(CB4)
I: 1849428-1849490 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AAAAUCCCACAUUCUAGAACAUUCUCCGAUCUUUGGUGAUUCAGCUUAAAUGAUAGAAUUCAGACGUCUUCAUAAAGCUAGGUUACCAAAGCUCGGCGUUCCAGUUCGACCAUUUUAAUCCUU
Get precursor sequence
Structure
        10        20          30        40        50        60 
AAAAUCCCACAUUCUAGAACAUUCU--|   U          UC     AA    UAGAAUU 
                           CCGA CUUUGGUGAU  AGCUU  AUGA       C
                           GGCU GAAACCAUUG  UCGAA  UACU       A
UUCCUAAUUUUACCAGCUUGACCUUGC^   C          GA     A-    UCUGCAG 
 120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 Cb Ea Ma Yo
Star sequence

Cbr-Mir-9-P18_5p*

MirBase accessionNone
Sequence
0- CUUUGGUGAUUCAGCUUAAAUGA -23
Get sequence
Mature sequence

Cbr-Mir-9-P18_3p

MirBase accessionMIMAT0000486
Sequence
41- AUAAAGCUAGGUUACCAAAGCU -63
Get sequence