MirGeneDB

MirGeneDB ID

Cbr-Mir-279-o8a

Family name MIR-279 (all species)
Seed GACUAGA
Species Roundworm (Caenorhabditis briggsae)
MiRBase ID cbr-mir-45-1
Paralogues Cbr-Mir-279-o7  Cbr-Mir-279-o8b  Cbr-Mir-279-o9  Cbr-Mir-279-o10 
Orthologues Cel-Mir-279-o8  Cgi-Mir-279  Isc-Mir-279  Lgi-Mir-279 
Node of Origin (locus) C. briggsae
Node of Origin (family) Protostomia
Genome context
(CB4)
II: 8900359-8900424 [-] Ensembl
Clustered MiRNAs
(< 10kb from Mir-279-o8a)
Mir-279-o7 II: 8891068-8891135 [-] Ensembl
Mir-2-o11 II: 8891220-8891282 [-] Ensembl
Mir-36-o25 II: 8891373-8891435 [-] Ensembl
Mir-279-o8a II: 8900359-8900424 [-] Ensembl
Mir-279-o8b II: 8903154-8903219 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
AGGUAAGCUUUUCUGCUAAACAGUGCCACGCUGGAUGUGCUCGUUAGUCAUAGUAACCUCAUCAAUUCAGGCUUAUGACUAGAGACACAUUCAGCUUGGCGCCAAACUAUGCAGAACUUUUUUAUC
Get precursor sequence
Structure
        10        20          30         40        50        60   
AGGUAAGCUUUUCUGCUAAACA--      C          -|  GU        GUAACCUCAU 
                        GUGCCA GCUGGAUGUG CUC  UAGUCAUA          \
                        CGCGGU CGACUUACAC GAG  AUCAGUAU          C
CUAUUUUUUCAAGACGUAUCAAAC      U          A^  --        UCGGACUUAA 
    120       110       100        90          80        70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-279 genes were present in the last common ancestor of protostomes and how the Drosophila Mir-279s relate to the other invertebrate Mir-279s and thus these multiple paralogues in invertebrates are classified here as orphans pending new data.
3' NTU No
MotifsNo
Tissue expression
 +
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 Cb Ea Ma Yo
Star sequence

Cbr-Mir-279-o8a_5p*

MirBase accessionNone
Sequence
0- CUGGAUGUGCUCGUUAGUCAUA -22
Get sequence
Mature sequence

Cbr-Mir-279-o8a_3p

MirBase accessionMIMAT0000470
Sequence
45- UGACUAGAGACACAUUCAGCU -66
Get sequence