MirGeneDB

MirGeneDB ID

Cbr-Mir-124-P14

Family name MIR-124 (all species)
Seed AAGGCAC
Species Roundworm (Caenorhabditis briggsae)
MiRBase ID cbr-mir-124a
Paralogues Cbr-Mir-124-P15  Cbr-Mir-124-P16 
Orthologues Aae-Mir-124  Asu-Mir-124  Bfl-Mir-124  Bge-Mir-124  Cel-Mir-124  Cte-Mir-124  Dan-Mir-124  Dme-Mir-124  Dmo-Mir-124  Dpu-Mir-124  Hme-Mir-124  Isc-Mir-124  Lan-Mir-124  Pfl-Mir-124  Pmi-Mir-124  Sko-Mir-124  Spu-Mir-124  Tca-Mir-124 
Node of Origin (locus) C. briggsae
Node of Origin (family) Bilateria
Genome context
(CB4)
IV: 8910174-8910237 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
CAUUGAUACAUUUUUUCCAGUCGUCAUAUGGCGUCCACCUGAGUGACUUUAGUGGACAUGUAUAGUUUCCAACUAAGGCACGCGGUGAAUGCCACGUGGCAAUUCUGGGAUUCAGAAGGUUGGU
Get precursor sequence
Structure
        10        20          30        40        50        60  
CAUUGAUACAUUUUUUCCAGUC--|   UA      C    UGA   A       GGACAUGU 
                        GUCA  UGGCGU CACC   GUG CUUUAGU        A
                        CGGU  ACCGUA GUGG   CAC GGAAUCA        U
UGGUUGGAAGACUUAGGGUCUUAA^   GC      A    CG-   -       ACCUUUGA 
  120       110       100        90         80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
01 02 03 04 05 06 07 08 09 10 11 12 13 14 15 16 Cb Ea Ma Yo
Star sequence

Cbr-Mir-124-P14_5p*

MirBase accessionNone
Sequence
0- GCGUCCACCUGAGUGACUUUAGU -23
Get sequence
Mature sequence

Cbr-Mir-124-P14_3p

MirBase accessionMIMAT0000494
Sequence
43- UAAGGCACGCGGUGAAUGCCA -64
Get sequence