MirGeneDB

MirGeneDB ID

Bta-Mir-95-P3-v2

Family name MIR-95 (all species)
Seed CAGUAAA
Species Cow (Bos taurus)
MiRBase ID bta-mir-545
Paralogues Bta-Mir-95-P1  Bta-Mir-95-P2  Bta-Mir-95-P3-v1  Bta-Mir-95-P4 
Orthologues Cfa-Mir-95-P3-v1  Cfa-Mir-95-P3-v2  Cpo-Mir-95-P3-v1  Cpo-Mir-95-P3-v2  Dno-Mir-95-P3-v1  Dno-Mir-95-P3-v2  Hsa-Mir-95-P3-v1  Hsa-Mir-95-P3-v2  Mml-Mir-95-P3-v1  Mml-Mir-95-P3-v2  Ocu-Mir-95-P3-v1  Ocu-Mir-95-P3-v2 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(bosTau8)
chrX: 81951397-81951456 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-95-P3-v2)
Mir-374-P1 chrX: 81951234-81951285 [+] UCSC Ensembl
Mir-95-P3-v1 chrX: 81951395-81951457 [+] UCSC Ensembl
Mir-95-P3-v2 chrX: 81951397-81951456 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCAGAGCCCAGCCUGGCACAUUCGUAGGCCUCAGUAAAUGUUUAUUGGAUGAAUAAAUGAAUGGCUCAUCAACAAACAUUUAUUGUGUGCCUGCUAACGUGAUCUCCACAGGCUCUGAAC
Get precursor sequence
Structure
        10        20           30         40        50         
CCAGAGCCCAGCCUGGCACAUUC---      CU-|           AUUG     AUAAAU 
                          GUAGGC   CAGUAAAUGUUU    GAUGA      \
                          CGUCCG   GUUAUUUACAAA    CUACU      G
CAAGUCUCGGACACCUCUAGUGCAAU      UGU^           CAA-     CGGUAA 
.       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-95-P3-v2_5p

MirBase accessionMIMAT0003806
Sequence
0- UCAGUAAAUGUUUAUUGGAUGA -22
Get sequence
Validated targets TargetScanVert: bta-miR-545-5p
Star sequence

Bta-Mir-95-P3-v2_3p*

MirBase accessionMIMAT0003807
Sequence
37- AUCAACAAACAUUUAUUGUGUGC -60
Get sequence
Validated targets TargetScanVert: bta-miR-545-3p