MirGeneDB

MirGeneDB ID

Bta-Mir-95-P2

Family name MIR-95 (all species)
Seed UCAACAG
Species Cow (Bos taurus)
MiRBase ID bta-mir-421
Paralogues Bta-Mir-95-P1  Bta-Mir-95-P3-v1  Bta-Mir-95-P3-v2  Bta-Mir-95-P4 
Orthologues Cfa-Mir-95-P2  Dno-Mir-95-P2  Hsa-Mir-95-P2  Mml-Mir-95-P2  Mmu-Mir-95-P2  Ocu-Mir-95-P2  Rno-Mir-95-P2 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(bosTau8)
chrX: 82024092-82024148 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-95-P2)
Mir-374-P2 chrX: 82023932-82023983 [+] UCSC Ensembl
Mir-95-P2 chrX: 82024092-82024148 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCAGUGCCUAAUCCGGUGCACAUUGUAGGCCUCAUUAAAUGUUUGUUGAAUGAAAAAAUGAAUCAUCAACAGACAUUAAUUGGGCGCCUGCUCUGUGAUCUCCAUGGGCUCAUCUUG
Get precursor sequence
Structure
        10          20        30         40        50        
GCAGUGCCUAAUCCGGUG--    UU      -|   UUA            A   AAAA 
                    CACA  GUAGGC CUCA   AAUGUUUGUUGA UGA    \
                    GUGU  CGUCCG GGGU   UUACAGACAACU ACU    A
GUUCUACUCGGGUACCUCUA    CU      C^   UAA            -   AAGU 
     110       100        90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-95-P2_5p*

MirBase accessionNone
Sequence
0- CUCAUUAAAUGUUUGUUGAAUGA -23
Get sequence
Mature sequence

Bta-Mir-95-P2_3p

MirBase accessionMIMAT0009314
Sequence
34- AUCAACAGACAUUAAUUGGGCGC -57
Get sequence
Validated targets TargetScanVert: bta-miR-421