MirGeneDB

MirGeneDB ID

Bta-Mir-92-P2b

Family name MIR-92 (all species)
Seed AUUGCAC
Species Cow (Bos taurus)
MiRBase ID bta-mir-363
Paralogues Bta-Mir-92-P1a  Bta-Mir-92-P1b  Bta-Mir-92-P1c  Bta-Mir-92-P2a  Bta-Mir-92-P2c 
Orthologues Aca-Mir-92-P2b  Asu-Mir-92  Bfl-Mir-92-o2b  Cel-Mir-92  Cfa-Mir-92-P2b  Cli-Mir-92-P2b  Cpi-Mir-92-P2b  Cpo-Mir-92-P2b  Dno-Mir-92-P2b  Dre-Mir-92-P2b1  Ete-Mir-92-P2b  Gga-Mir-92-P2b  Hsa-Mir-92-P2b  Isc-Mir-92  Mdo-Mir-92-P2b  Mml-Mir-92-P2b  Mmu-Mir-92-P2b  Oan-Mir-92-P2b  Ocu-Mir-92-P2b  Rno-Mir-92-P2b  Sha-Mir-92-P2b  Sto-Mir-92-P2b  Tgu-Mir-92-P2b  Xtr-Mir-92-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(bosTau8)
chrX: 17917705-17917769 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-P2b)
Mir-92-P2b chrX: 17917705-17917769 [-] UCSC Ensembl
Mir-92-P1b chrX: 17917863-17917923 [-] UCSC Ensembl
Mir-19-P2b chrX: 17918013-17918074 [-] UCSC Ensembl
Mir-17-P3b chrX: 17918136-17918196 [-] UCSC Ensembl
Mir-17-P2b chrX: 17918371-17918435 [-] UCSC Ensembl
Mir-17-P1b chrX: 17918537-17918595 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCAUUGUAAAAUGACCUGUUUUGCUGUUGUCGGGUGGAUCACGAUGCAAUUUUGAUUAGUAUAAUAGGAGAAAAAUUGCACGGUAUCCAUCUGCGAACCGCAGGACCCUUGUUGACAACAGUCUG
Get precursor sequence
Structure
        10          20        30        40        50        60  
UCAUUGUAAAAUGACCU--|      U   GU         CA  A         GAUUAGUA 
                   GUUUUGC GUU  CGGGUGGAU  CG UGCAAUUUU        U
                   CAGGACG CAA  GUCUACCUA  GC ACGUUAAAA        A
GUCUGACAACAGUUGUUCC^      C   GC         UG  -         AGAGGAUA 
   120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-92-P2b_5p*

MirBase accessionNone
Sequence
0- CGGGUGGAUCACGAUGCAAUUUU -23
Get sequence
Mature sequence

Bta-Mir-92-P2b_3p

MirBase accessionMIMAT0003855
Sequence
43- AAUUGCACGGUAUCCAUCUGCG -65
Get sequence
Validated targets TargetScanVert: bta-miR-363