MirGeneDB

MirGeneDB ID

Bta-Mir-92-P1b

Family name MIR-92 (all species)
Seed AUUGCAC
Species Cow (Bos taurus)
MiRBase ID bta-mir-92a-2
Paralogues Bta-Mir-92-P1a  Bta-Mir-92-P1c  Bta-Mir-92-P2a  Bta-Mir-92-P2b  Bta-Mir-92-P2c 
Orthologues Aca-Mir-92-P1b  Asu-Mir-92  Bfl-Mir-92-o1  Cel-Mir-92  Cfa-Mir-92-P1b  Cli-Mir-92-P1b  Cpi-Mir-92-P1b  Cpo-Mir-92-P1b  Dno-Mir-92-P1b  Ete-Mir-92-P1b  Gga-Mir-92-P1b  Hsa-Mir-92-P1b  Isc-Mir-92  Mdo-Mir-92-P1b  Mml-Mir-92-P1b  Mmu-Mir-92-P1b  Oan-Mir-92-P1b  Ocu-Mir-92-P1b  Rno-Mir-92-P1b  Sha-Mir-92-P1b  Sto-Mir-92-P1b  Tgu-Mir-92-P1b  Xtr-Mir-92-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(bosTau8)
chrX: 17917863-17917923 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-P1b)
Mir-92-P2b chrX: 17917705-17917769 [-] UCSC Ensembl
Mir-92-P1b chrX: 17917863-17917923 [-] UCSC Ensembl
Mir-19-P2b chrX: 17918013-17918074 [-] UCSC Ensembl
Mir-17-P3b chrX: 17918136-17918196 [-] UCSC Ensembl
Mir-17-P2b chrX: 17918371-17918435 [-] UCSC Ensembl
Mir-17-P1b chrX: 17918537-17918595 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AAUCUCCAGUCUUCGCACCCAUUCAUUCAUGGGUGGGGAUUUGUUGCACUGCUUGUGUUAUAUAUAAAGUAUUGCACUUGUCCCGGCCUGUGGAAGAAAUGAGGAAUUUAUCAUCUUCUUU
Get precursor sequence
Structure
        10         20         30        40        50        60
AAUCUCCAGUCUUCGCACC-  -|  A         G     UU  U   C    UGUGUU 
                    CA UUC UUCAUGGGU GGGAU  GU GCA UGCU      A
                    GU AAG AGGUGUCCG CCCUG  CA CGU AUGA      U
UUUCUUCUACUAUUUAAGGA  A^  A         G     UU  -   U    AAUAUA 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-92-P1b_5p*

MirBase accessionNone
Sequence
0- GGGUGGGGAUUUGUUGCACUGCU -23
Get sequence
Mature sequence

Bta-Mir-92-P1b_3p

MirBase accessionMIMAT0009383
Sequence
39- UAUUGCACUUGUCCCGGCCUGU -61
Get sequence
Validated targets TargetScanVert: bta-miR-92a