MirGeneDB

MirGeneDB ID

Bta-Mir-29-P2b6

Family name MIR-29 (all species)
Seed UGGUUUC
Species Cow (Bos taurus)
MiRBase ID bta-mir-29e
Paralogues Bta-Mir-29-P1a  Bta-Mir-29-P1b  Bta-Mir-29-P2a  Bta-Mir-29-P2b5 
Orthologues Aae-Mir-29-P2  Aca-Mir-29-P2b-v1  Aca-Mir-29-P2b-v2  Ami-Mir-29-P2b-v1  Ami-Mir-29-P2b-v2  Asu-Mir-29-P2  Bfl-Mir-29-P2  Cbr-Mir-29-P2  Cel-Mir-29-P2  Cfa-Mir-29-P2b-v1  Cfa-Mir-29-P2b-v2  Cgi-Mir-29-P2  Cli-Mir-29-P2b-v1  Cli-Mir-29-P2b-v2  Cpi-Mir-29-P2b-v1  Cpi-Mir-29-P2b-v2  Cpo-Mir-29-P2b  Cte-Mir-29-P2  Dan-Mir-29-P2  Dme-Mir-29-P2  Dmo-Mir-29-P2  Dno-Mir-29-P2b-v1  Dno-Mir-29-P2b-v2  Ete-Mir-29-P2b-v1  Ete-Mir-29-P2b-v2  Gga-Mir-29-P2b-v1  Gga-Mir-29-P2b-v2  Hme-Mir-29-P2  Hsa-Mir-29-P2b-v1  Hsa-Mir-29-P2b-v2  Mdo-Mir-29-P2b-v1  Mdo-Mir-29-P2b-v2  Mml-Mir-29-P2b-v1  Mml-Mir-29-P2b-v2  Mmu-Mir-29-P2b  Oan-Mir-29-P2b-v1  Oan-Mir-29-P2b-v2  Ocu-Mir-29-P2b  Pfl-Mir-29-P2  Pmi-Mir-29-P2  Sha-Mir-29-P2b-v1  Sha-Mir-29-P2b-v2  Sko-Mir-29-P2  Spu-Mir-29-P2  Sto-Mir-29-P2b  Tca-Mir-29-P2  Tgu-Mir-29-P2b-v1  Tgu-Mir-29-P2b-v2  Xtr-Mir-29-P2b 
Node of Origin (locus) B. taurus
Node of Origin (family) Bilateria
Genome context
(bosTau8)
chr16: 77562009-77562072 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCUUCAGUGAGAAUCCUCUUCUUCUGGAAGCUGGUUUCACAUGGUGGCUUAGAUUUUUCCAUCUUUGUAUCUAGCAUCAUUUGAAAUCAGUGUUUUAGGAGUAAGAAUUGCAGCACAGCCAAAG
Get precursor sequence
Structure
        10          20          30        40        50        60 
UCUUCAGUGAGAAUCCU--   -         -|         C      G  U   UUUUUCC 
                   CUU CUUCUGGAA GCUGGUUUCA AUGGUG CU AGA       A
                   GAA GAGGAUUUU UGACUAAAGU UACUAC GA UCU       U
GAAACCGACACGACGUUAA   U         G^         U      -  -   AUGUUUC 
  120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-29-P2b6_5p

MirBase accessionNone
Sequence
0- CUGGUUUCACAUGGUGGCUUAGA -23
Get sequence
Star sequence

Bta-Mir-29-P2b6_3p*

MirBase accessionMIMAT0009953
Sequence
41- UAGCAUCAUUUGAAAUCAGUGUU -64
Get sequence
Validated targets TargetScanVert: bta-miR-29e