MirGeneDB

MirGeneDB ID

Bta-Mir-29-P2a

Family name MIR-29 (all species)
Seed AGCACCA
Species Cow (Bos taurus)
MiRBase ID bta-mir-29b-1
Paralogues Bta-Mir-29-P1a  Bta-Mir-29-P1b  Bta-Mir-29-P2b5  Bta-Mir-29-P2b6 
Orthologues Aae-Mir-29-P2  Aca-Mir-29-P2a  Ami-Mir-29-P2a-v1  Ami-Mir-29-P2a-v2  Asu-Mir-29-P2  Bfl-Mir-29-P2  Cbr-Mir-29-P2  Cel-Mir-29-P2  Cfa-Mir-29-P2a  Cgi-Mir-29-P2  Cli-Mir-29-P2a  Cpi-Mir-29-P2a  Cpo-Mir-29-P2a  Cte-Mir-29-P2  Dan-Mir-29-P2  Dme-Mir-29-P2  Dmo-Mir-29-P2  Dno-Mir-29-P2a  Dre-Mir-29-P2a  Ete-Mir-29-P2a  Gga-Mir-29-P2a  Hme-Mir-29-P2  Hsa-Mir-29-P2a  Mdo-Mir-29-P2a  Mml-Mir-29-P2a  Mmu-Mir-29-P2a  Oan-Mir-29-P2a  Ocu-Mir-29-P2a  Pfl-Mir-29-P2  Pmi-Mir-29-P2  Rno-Mir-29-P2a  Sha-Mir-29-P2a  Sko-Mir-29-P2  Spu-Mir-29-P2  Sto-Mir-29-P2a  Tca-Mir-29-P2  Tgu-Mir-29-P2a  Xtr-Mir-29-P2a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(bosTau8)
chr4: 95402702-95402765 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-29-P2a)
Mir-29-P1a chr4: 95402320-95402379 [-] UCSC Ensembl
Mir-29-P2a chr4: 95402702-95402765 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAAGAACAGAUCUUAAAGCUUCUUCAGGAAGCUGGUUUCAUAUGGUGGUUUAGAUUUAAAUAGUGAUUGUCUAGCACCAUUUGAAAUCAGUGUUCUUGGGGGAGACCAGCUGCACCGCCGGCAG
Get precursor sequence
Structure
        10          20        30         40        50        60  
GAAGAACAGAUCUUAAAG--            -|         U      GU     UUUAAAU 
                    CUUCUUCAGGAA GCUGGUUUCA AUGGUG  UUAGA       \
                    GAGGGGGUUCUU UGACUAAAGU UACCAC  GAUCU       A
GACGGCCGCCACGUCGACCA            G^         U      --     GUUAGUG 
  120       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-29-P2a_5p*

MirBase accessionNone
Sequence
0- GCUGGUUUCAUAUGGUGGUUUAGA -24
Get sequence
Mature sequence

Bta-Mir-29-P2a_3p

MirBase accessionMIMAT0003828
Sequence
41- UAGCACCAUUUGAAAUCAGUGUU -64
Get sequence
Validated targets TargetScanVert: bta-miR-29b