MirGeneDB

MirGeneDB ID

Bta-Mir-28-P3

Family name MIR-28 (all species)
Seed AGGAGCU
Species Cow (Bos taurus)
MiRBase ID bta-mir-708
Paralogues Bta-Mir-28-P1  Bta-Mir-28-P2 
Orthologues Cfa-Mir-28-P3  Cpo-Mir-28-P3  Dno-Mir-28-P3  Ete-Mir-28-P3  Hsa-Mir-28-P3  Mml-Mir-28-P3  Mmu-Mir-28-P3  Ocu-Mir-28-P3  Rno-Mir-28-P3 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(bosTau8)
chr29: 16686250-16686318 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACUGCUGUGUGUGAAGUGGUAACUGCCCUCAAGGAGCUUACAAUCUAGCUGGGGGUAAACGACUUGCACAUGAACGCAUCUAGACUGUGAGCUUCUAGAGGGCAGGGACCUUACCCUAAGUCAUCUCUC
Get precursor sequence
Structure
        10          20        30        40        50        60    
ACUGCUGUGUGUGAAGU--|  AA        A           A     C  GGGGUAAACGAC 
                   GGU  CUGCCCUC AGGAGCUUACA UCUAG UG            \
                   CCA  GACGGGAG UCUUCGAGUGU AGAUC AC            U
CUCUCUACUGAAUCCCAUU^  GG        A           C     U  GCAAGUACACGU 
       120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-28-P3_5p

MirBase accessionMIMAT0009367
Sequence
0- AAGGAGCUUACAAUCUAGCUGGG -23
Get sequence
Validated targets TargetScanVert: bta-miR-708
Star sequence

Bta-Mir-28-P3_3p*

MirBase accessionNone
Sequence
46- CAUCUAGACUGUGAGCUUCUAGA -69
Get sequence