MirGeneDB

MirGeneDB ID

Bta-Mir-24-P1

Family name MIR-24 (all species)
Seed GGCUCAG
Species Cow (Bos taurus)
MiRBase ID bta-mir-24-2
Paralogues Bta-Mir-24-P2 
Orthologues Aca-Mir-24-P1  Ami-Mir-24-P1  Cfa-Mir-24-P1  Cpi-Mir-24-P1  Cpo-Mir-24-P1  Dno-Mir-24-P1  Dre-Mir-24-P1  Ete-Mir-24-P1  Hsa-Mir-24-P1  Mdo-Mir-24-P1  Mml-Mir-24-P1  Mmu-Mir-24-P1  Oan-Mir-24-P1  Ocu-Mir-24-P1  Rno-Mir-24-P1  Sha-Mir-24-P1  Sto-Mir-24-o1  Sto-Mir-24-P1  Xtr-Mir-24-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(bosTau8)
chr7: 12981643-12981702 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-24-P1)
Mir-24-P1 chr7: 12981643-12981702 [-] UCSC Ensembl
Mir-27-P1 chr7: 12981795-12981855 [-] UCSC Ensembl
Mir-23-P1 chr7: 12981977-12982034 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACCUCGGGGCCUCCCUGGGCUCUGCCUCCCGUGCCUACUGAGCUGAAACACAGUUGAUUUGUGCACACUGGCUCAGUUCAGCAGGAACAGGAGUCAAGCCCCCUUGGAGUCUGCUGUGGC
Get precursor sequence
Structure
        10           20        30        40        50        60
ACCUCGGGGCCUCCCUG---|   C  C    C  G   A         AACA    UGAUU 
                    GGCU UG CUCC GU CCU CUGAGCUGA    CAGU     U
                    CCGA AC GAGG CA GGA GACUUGACU    GUCA     G
CGGUGUCGUCUGAGGUUCCC^   -  U    A  A   C         CG--    CACGU 
.       110       100         90        80          70
Deep sequencing
Go to detailed chart
3' NTU Yes
MotifsNo
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-24-P1_5p*

MirBase accessionNone
Sequence
0- GUGCCUACUGAGCUGAAACACAGU -24
Get sequence
Mature sequence

Bta-Mir-24-P1_3p

MirBase accessionMIMAT0003840
Sequence
38- UGGCUCAGUUCAGCAGGAACAG -60
Get sequence
Validated targets TargetScanVert: bta-miR-24-3p