MirGeneDB

MirGeneDB ID

Bta-Mir-219-P1

Family name MIR-219 (all species)
Seed GAUUGUC
Species Cow (Bos taurus)
MiRBase ID bta-mir-219-2
Paralogues Bta-Mir-219-P2  Bta-Mir-219-P2-as 
Orthologues Aae-Mir-219  Aca-Mir-219-P1  Ami-Mir-219-P1  Bfl-Mir-219  Bge-Mir-219  Cfa-Mir-219-P1  Cgi-Mir-219  Cin-Mir-219  Cpi-Mir-219-P1  Cpo-Mir-219-P1  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P1  Dpu-Mir-219  Dre-Mir-219-P1a  Ete-Mir-219-P1  Hsa-Mir-219-P1  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P1  Mml-Mir-219-P1  Mmu-Mir-219-P1  Mmu-Mir-219-P1-as  Ocu-Mir-219-P1  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P1  Sha-Mir-219-P1  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P1-v1  Sto-Mir-219-P1-v2  Tca-Mir-219 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(bosTau8)
chr23: 7335349-7335412 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCUCCCUCCCCCGCCCCGGGCCGCGGCUCCUGAUUGUCCAAACGCAAUUCUCGAGUCUCUAGCUCUGGCCGAGAGUUGAGUCUGGACGUCCCGAGCCGUCGCCCCCAAACCUCGAGGGGGAGAG
Get precursor sequence
Structure
        10           20        30        40        50        60 
CCUCCCUCCCCCGCCCC---|   C       CU   U     A  G         AGUCUCU 
                    GGGC GCGGCUC  GAU GUCCA AC CAAUUCUCG       A
                    CCCG UGCCGAG  CUG CAGGU UG GUUGAGAGC       G
GAGAGGGGGAGCUCCAAACC^   C       CC   -     C  A         CGGUCUC 
  120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-219-P1_5p

MirBase accessionNone
Sequence
0- UGAUUGUCCAAACGCAAUUCUCG -23
Get sequence
Star sequence

Bta-Mir-219-P1_3p*

MirBase accessionMIMAT0030444
Sequence
41- AGAGUUGAGUCUGGACGUCCCGA -64
Get sequence
Validated targets TargetScanVert: bta-miR-219