MirGeneDB

MirGeneDB ID

Bta-Mir-205-P1

Family name MIR-205 (all species)
Seed CCUUCAU
Species Cow (Bos taurus)
MiRBase ID bta-mir-205
Paralogues
Orthologues Aca-Mir-205-P1  Ami-Mir-205-P1  Cfa-Mir-205-P1  Cli-Mir-205-P1  Cpi-Mir-205-P1  Cpo-Mir-205-P1  Dno-Mir-205-P1  Dre-Mir-205-P1  Ete-Mir-205-P1  Gga-Mir-205-P1  Hsa-Mir-205-P1  Mdo-Mir-205-P1  Mml-Mir-205-P1  Mmu-Mir-205-P1  Oan-Mir-205-P1  Ocu-Mir-205-P1  Rno-Mir-205-P1  Sha-Mir-205-P1  Sto-Mir-205-P1  Tgu-Mir-205-P1a  Tgu-Mir-205-P1b  Xtr-Mir-205-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(bosTau8)
chr16: 75799970-75800028 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGACCUCAGAUAGUCCAUGUGCUUCUCUUGUCCUUCAUUCCACCGGAGUCUGUCUCGUACCCAACCAGAUUUCAGUGGAGUGAAGUUCAGGAGGCGUGGAACUGACACCGGAGCUGCCG
Get precursor sequence
Structure
        10        20          30        40        50         
AGACCUCAGAUAGUCCAUGU--| U       UC           C        UCUCGU 
                      GC UCUCUUG  CUUCAUUCCAC GGAGUCUG      \
                      UG GGAGGAC  GAAGUGAGGUG CUUUAGAC      A
GCCGUCGAGGCCACAGUCAAGG^ C       UU           A        CAACCC 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-205-P1_5p

MirBase accessionMIMAT0003545
Sequence
0- UCCUUCAUUCCACCGGAGUCUGU -23
Get sequence
Validated targets TargetScanVert: bta-miR-205
Star sequence

Bta-Mir-205-P1_3p*

MirBase accessionNone
Sequence
37- GAUUUCAGUGGAGUGAAGUUCA -59
Get sequence