MirGeneDB

MirGeneDB ID

Bta-Mir-190-P2

Family name MIR-190 (all species)
Seed GAUAUGU
Species Cow (Bos taurus)
MiRBase ID bta-mir-190b
Paralogues Bta-Mir-190-P1 
Orthologues Aae-Mir-190  Aca-Mir-190-P2  Ami-Mir-190-P2  Asu-Mir-190  Bfl-Mir-190  Bge-Mir-190  Cbr-Mir-190  Cel-Mir-190  Cfa-Mir-190-P2  Cgi-Mir-190  Cpi-Mir-190-P2  Cpo-Mir-190-P2  Cte-Mir-190  Dan-Mir-190  Dme-Mir-190  Dmo-Mir-190  Dno-Mir-190-P2  Dpu-Mir-190  Dre-Mir-190-P2  Ete-Mir-190-P2  Gga-Mir-190-P2  Hme-Mir-190  Hsa-Mir-190-P2  Isc-Mir-190  Mdo-Mir-190-P2  Mml-Mir-190-P2  Mmu-Mir-190-P2  Oan-Mir-190-P2  Ocu-Mir-190-P2  Pfl-Mir-190  Pmi-Mir-190  Rno-Mir-190-P2  Sha-Mir-190-P2  Sko-Mir-190  Sto-Mir-190-P2  Tca-Mir-190  Tgu-Mir-190-P2  Xtr-Mir-190-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(bosTau8)
chr3: 16374614-16374673 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCCGCGAAAGCUCUUCUGCCUGCUUCUGUGUGAUAUGUUUGAUAUUGGGUUGUUUAAUUAGGAACCAACUAAAUGUCAAACAUAUUCUUACAGCAGUAGGCAAUUUGGCAUCAUACUCUU
Get precursor sequence
Structure
        10          20        30         40        50         
GCCGCGAAAGCUCUUCU--       U     U-|              G     UUUAAU 
                   GCCUGCU CUGUG  GAUAUGUUUGAUAUU GGUUG      \
                   CGGAUGA GACAU  UUAUACAAACUGUAA UCAAC      U
UUCUCAUACUACGGUUUAA       C     UC^              A     CAAGGA 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU Unknown
MotifsUG at 5p(-14)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-190-P2_5p

MirBase accessionMIMAT0009252
Sequence
0- UGAUAUGUUUGAUAUUGGGUUGU -23
Get sequence
Validated targets TargetScanVert: bta-miR-190b
Star sequence

Bta-Mir-190-P2_3p* (predicted)

MirBase accessionNone
Sequence
36- AACUAAAUGUCAAACAUAUUCUUA -60
Get sequence