MirGeneDB

MirGeneDB ID

Bta-Mir-19-P2b

Family name MIR-19 (all species)
Seed GUGCAAA
Species Cow (Bos taurus)
MiRBase ID bta-mir-19b-2
Paralogues Bta-Mir-19-P1  Bta-Mir-19-P2a 
Orthologues Aca-Mir-19-P2b  Cfa-Mir-19-P2b  Cli-Mir-19-P2b  Cpi-Mir-19-P2b  Cpo-Mir-19-P2b  Dno-Mir-19-P2b  Dre-Mir-19-P2b1  Ete-Mir-19-P2b  Gga-Mir-19-P2b  Hsa-Mir-19-P2b  Mdo-Mir-19-P2b  Mml-Mir-19-P2b  Mmu-Mir-19-P2b  Oan-Mir-19-P2b  Ocu-Mir-19-P2b  Rno-Mir-19-P2b  Sha-Mir-19-P2b  Sto-Mir-19-P2b  Tgu-Mir-19-P2b  Xtr-Mir-19-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(bosTau8)
chrX: 17918013-17918074 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-19-P2b)
Mir-92-P2b chrX: 17917705-17917769 [-] UCSC Ensembl
Mir-92-P1b chrX: 17917863-17917923 [-] UCSC Ensembl
Mir-19-P2b chrX: 17918013-17918074 [-] UCSC Ensembl
Mir-17-P3b chrX: 17918136-17918196 [-] UCSC Ensembl
Mir-17-P2b chrX: 17918371-17918435 [-] UCSC Ensembl
Mir-17-P1b chrX: 17918537-17918595 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAACAUUCAAAGACACUGCUACUUACAGUUAGUUUUGCUGGUUUGCAUUUCAGCGUGUGGAUAUAUGGCUGUGCAAAUCCAUGCAAAACUGAUUGUGAUACUGUGUUUCUUCUGCGGCCCUA
Get precursor sequence
Structure
        10        20          30         40         50        60 
GAACAUUCAAAGACACUGCUAC--                -   -|     UUU    GUGUGG 
                        UUACAGUUAGUUUUGC UGG UUUGCA   CAGC      \
                        AGUGUUAGUCAAAACG ACC AAACGU   GUCG      A
AUCCCGGCGUCUUCUUUGUGUCAU                U   U^     ---    GUAUAU 
120       110       100        90        80           70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-19-P2b_5p* (predicted)

MirBase accessionNone
Sequence
0- AGUUUUGCUGGUUUGCAUUUCAGC -24
Get sequence
Mature sequence

Bta-Mir-19-P2b_3p

MirBase accessionMIMAT0004337
Sequence
39- UGUGCAAAUCCAUGCAAAACUGA -62
Get sequence
Validated targets TargetScanVert: bta-miR-19b