MirGeneDB

MirGeneDB ID

Bta-Mir-17-P3a

Family name MIR-17 (all species)
Seed AAAGUGC
Species Cow (Bos taurus)
MiRBase ID bta-mir-20a
Paralogues Bta-Mir-17-P1a  Bta-Mir-17-P1b  Bta-Mir-17-P1c  Bta-Mir-17-P2a  Bta-Mir-17-P2b  Bta-Mir-17-P3b  Bta-Mir-17-P3c 
Orthologues Aca-Mir-17-P3a  Ami-Mir-17-P3a  Cfa-Mir-17-P3a  Cli-Mir-17-P3a  Cpi-Mir-17-P3a  Cpo-Mir-17-P3a  Dno-Mir-17-P3a  Dre-Mir-17-P3a1  Ete-Mir-17-P3a  Gga-Mir-17-P3a  Hsa-Mir-17-P3a  Mdo-Mir-17-P3a  Mml-Mir-17-P3a  Mmu-Mir-17-P3a  Oan-Mir-17-P3a3  Oan-Mir-17-P3a4  Ocu-Mir-17-P3a  Rno-Mir-17-P3a  Sha-Mir-17-P3a  Sto-Mir-17-P3a  Tgu-Mir-17-P3a1  Tgu-Mir-17-P3a2  Xtr-Mir-17-P3a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(bosTau8)
chr12: 66227012-66227070 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-17-P3a)
Mir-17-P1a chr12: 66226567-66226626 [+] UCSC Ensembl
Mir-17-P2a chr12: 66226702-66226765 [+] UCSC Ensembl
Mir-19-P1 chr12: 66226849-66226906 [+] UCSC Ensembl
Mir-17-P3a chr12: 66227012-66227070 [+] UCSC Ensembl
Mir-19-P2a chr12: 66227148-66227208 [+] UCSC Ensembl
Mir-92-P1a chr12: 66227265-66227323 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UGGUGUGUGACAUGACAGCUUCUGUAGCACUAAAGUGCUUAUAGUGCAGGUAGUGUUUAGUUAUCUACUGCAUUAUGAGCACUUAAAGUACUGCUAGCUGUAGAACUCCAGCUUCGGCC
Get precursor sequence
Structure
        10            20        30         40        50         
UGGUGUGUGACAUGACA----|  UCU    C   A-                 G   UGUUU 
                     GCU   GUAG ACU  AAGUGCUUAUAGUGCAG UAG     \
                     CGA   CGUC UGA  UUCACGAGUAUUACGUC AUC     A
CCGGCUUCGACCUCAAGAUGU^  U--    A   AA                 -   UAUUG 
       110       100          90        80        70         60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-17-P3a_5p

MirBase accessionMIMAT0003527
Sequence
0- UAAAGUGCUUAUAGUGCAGGUAG -23
Get sequence
Validated targets TargetScanVert: bta-miR-20a
Star sequence

Bta-Mir-17-P3a_3p*

MirBase accessionNone
Sequence
36- ACUGCAUUAUGAGCACUUAAAGU -59
Get sequence