MirGeneDB

MirGeneDB ID

Bta-Mir-17-P2b

Family name MIR-17 (all species)
Seed AAGGUGC
Species Cow (Bos taurus)
MiRBase ID bta-mir-18b
Paralogues Bta-Mir-17-P1a  Bta-Mir-17-P1b  Bta-Mir-17-P1c  Bta-Mir-17-P2a  Bta-Mir-17-P3a  Bta-Mir-17-P3b  Bta-Mir-17-P3c 
Orthologues Aca-Mir-17-P2b  Cfa-Mir-17-P2b  Cli-Mir-17-P2b  Cpi-Mir-17-P2b  Cpo-Mir-17-P2b  Dno-Mir-17-P2b  Dre-Mir-17-P2b1  Ete-Mir-17-P2b  Gga-Mir-17-P2b  Hsa-Mir-17-P2b  Mdo-Mir-17-P2b  Mml-Mir-17-P2b  Mmu-Mir-17-P2b  Oan-Mir-17-P2b  Ocu-Mir-17-P2b  Rno-Mir-17-P2b  Sha-Mir-17-P2b  Sto-Mir-17-P2b  Tgu-Mir-17-P2b  Xtr-Mir-17-P2b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(bosTau8)
chrX: 17918371-17918435 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-17-P2b)
Mir-92-P2b chrX: 17917705-17917769 [-] UCSC Ensembl
Mir-92-P1b chrX: 17917863-17917923 [-] UCSC Ensembl
Mir-19-P2b chrX: 17918013-17918074 [-] UCSC Ensembl
Mir-17-P3b chrX: 17918136-17918196 [-] UCSC Ensembl
Mir-17-P2b chrX: 17918371-17918435 [-] UCSC Ensembl
Mir-17-P1b chrX: 17918537-17918595 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GAGCUGUUUCCCAGAACGUGUCUCUUGUGUUAAGGUGCAUCUAGUGCAGUUAGUGAAGCAGCUCAGAAUCUACUGCCCUAAAUGCUCCUUCUGGCACAGGCUGCCUGACACACAGCAUUGGAAAA
Get precursor sequence
Structure
        10          20        30          40        50        60 
GAGCUGUUUCCCAGAACGU--  CU         --|  U    C   U     U  UGAAGCA 
                     GU  CUUGUGUUA  AGG GCAU UAG GCAGU AG       G
                     CG  GGACACGGU  UCC CGUA AUC CGUCA UC       C
AAAAGGUUACGACACACAGUC  UC         CU^  U    A   C     -  UAAGACU 
   120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-17-P2b_5p

MirBase accessionMIMAT0003517
Sequence
0- UAAGGUGCAUCUAGUGCAGUUAG -23
Get sequence
Validated targets TargetScanVert: bta-miR-18b
Star sequence

Bta-Mir-17-P2b_3p*

MirBase accessionNone
Sequence
40- UACUGCCCUAAAUGCUCCUUCUGGC -65
Get sequence