MirGeneDB

MirGeneDB ID

Bta-Mir-154-P20

Family name MIR-154 (all species)
Seed GAGUAUU
Species Cow (Bos taurus)
MiRBase ID bta-mir-496
Paralogues Bta-Mir-154-P1  Bta-Mir-154-P2-v1  Bta-Mir-154-P2-v2  Bta-Mir-154-P3a-v1  Bta-Mir-154-P3a-v2  Bta-Mir-154-P3b  Bta-Mir-154-P4a  Bta-Mir-154-P4b  Bta-Mir-154-P5  Bta-Mir-154-P6  Bta-Mir-154-P7  Bta-Mir-154-P8  Bta-Mir-154-P9  Bta-Mir-154-P10  Bta-Mir-154-P12  Bta-Mir-154-P13  Bta-Mir-154-P14  Bta-Mir-154-P15  Bta-Mir-154-P16  Bta-Mir-154-P17  Bta-Mir-154-P18  Bta-Mir-154-P19  Bta-Mir-154-P21  Bta-Mir-154-P22  Bta-Mir-154-P23  Bta-Mir-154-P24  Bta-Mir-154-P25  Bta-Mir-154-P26  Bta-Mir-154-P28  Bta-Mir-154-P29  Bta-Mir-154-P30  Bta-Mir-154-P31  Bta-Mir-154-P32  Bta-Mir-154-P33  Bta-Mir-154-P36  Bta-Mir-154-P37 
Orthologues Cfa-Mir-154-P20  Cpo-Mir-154-P20-v1  Cpo-Mir-154-P20-v2  Dno-Mir-154-P20-v1  Dno-Mir-154-P20-v2  Ete-Mir-154-P20-v1  Ete-Mir-154-P20-v2  Hsa-Mir-154-P20-v1  Hsa-Mir-154-P20-v2  Mml-Mir-154-P20-v1  Mml-Mir-154-P20-v2  Mmu-Mir-154-P20-v1  Mmu-Mir-154-P20-v2  Ocu-Mir-154-P20-v1  Ocu-Mir-154-P20-v2  Rno-Mir-154-P20-v1  Rno-Mir-154-P20-v2 
Node of Origin (locus) Eutheria
Node of Origin (family) Eutheria
Genome context
(bosTau8)
chr21: 67598891-67598944 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-154-P20)
Mir-154-P31 chr21: 67589488-67589541 [+] UCSC Ensembl
Mir-154-P16 chr21: 67589876-67589933 [+] UCSC Ensembl
Mir-154-P10 chr21: 67592888-67592945 [+] UCSC Ensembl
Mir-134 chr21: 67593262-67593324 [+] UCSC Ensembl
Mir-154-P15 chr21: 67593963-67594021 [+] UCSC Ensembl
Mir-154-P1 chr21: 67598053-67598110 [+] UCSC Ensembl
Mir-154-P32 chr21: 67598367-67598427 [+] UCSC Ensembl
Mir-154-P20 chr21: 67598891-67598944 [+] UCSC Ensembl
Mir-154-P6 chr21: 67600496-67600555 [+] UCSC Ensembl
Mir-541 chr21: 67602353-67602418 [+] UCSC Ensembl
Mir-3957 chr21: 67602740-67602798 [+] UCSC Ensembl
Mir-154-P36 chr21: 67603260-67603313 [+] UCSC Ensembl
Mir-154-P14 chr21: 67603405-67603460 [+] UCSC Ensembl
Mir-154-P5 chr21: 67603548-67603603 [+] UCSC Ensembl
Mir-154-P12 chr21: 67603879-67603934 [+] UCSC Ensembl
Mir-154-P25 chr21: 67604696-67604752 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCCAGCAUCCGAGUCGGGUACUCGAAUGGAGGUUGUCCAUGGUGUGUUCAUUUUAUUUAUGAUGAGUAUUACAUGGCCAAUCUCCUUUCAGUACUAAAUUCUUCAUGGGAAGAC
Get precursor sequence
Structure
        10           20        30        40        50      
GCCAGCAUCCGAGUCGG---|    C   U        U     GU         UUA 
                    GUACU GAA GGAGGUUG CCAUG  GUGUUCAUU   U
                    CAUGA CUU CCUCUAAC GGUAC  UAUGAGUAG   U
CAGAAGGGUACUUCUUAAAU^    -   U        C     AU         UAU 
  110       100        90         80        70        60
Deep sequencing
Go to detailed chart
CommentCow and dog do not express the second version that the other eutherians express.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-154-P20_5p* (predicted)

MirBase accessionNone
Sequence
0- GGUUGUCCAUGGUGUGUUCAUU -22
Get sequence
Mature sequence

Bta-Mir-154-P20_3p

MirBase accessionMIMAT0009336
Sequence
32- UGAGUAUUACAUGGCCAAUCUC -54
Get sequence
Validated targets TargetScanVert: bta-miR-496