MirGeneDB

MirGeneDB ID

Bta-Mir-148-P2

Family name MIR-148 (all species)
Seed CAGUGCA
Species Cow (Bos taurus)
MiRBase ID bta-mir-152
Paralogues Bta-Mir-148-P1  Bta-Mir-148-P3 
Orthologues Ami-Mir-148-P2  Cfa-Mir-148-P2  Cpi-Mir-148-P2  Cpo-Mir-148-P2  Dno-Mir-148-P2  Dre-Mir-148-P2  Hsa-Mir-148-P2  Mdo-Mir-148-P2  Mml-Mir-148-P2  Mmu-Mir-148-P2  Oan-Mir-148-P2  Ocu-Mir-148-P2  Rno-Mir-148-P2  Sha-Mir-148-P2  Sto-Mir-148-P2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(bosTau8)
chr19: 39081179-39081237 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGGAGCUCGGCGCCGCUGUCCUCCCGGCCCAGGUUCUGUGAUACACUCCGACUCGGGCUCUGGAGCAGUCAGUGCAUGACAGAACUUGGGCCCGGACGGACCUUCUGCACCCAAUGGGC
Get precursor sequence
Structure
        10         20         30        40        50          
AGGAGCUCGGCGCCGCU-    -|  C              G  A    CC    CGGGCU 
                  GUCC UCC GGCCCAGGUUCUGU AU CACU  GACU      \
                  CAGG AGG CCGGGUUCAAGACA UA GUGA  CUGA      C
CGGGUAACCCACGUCUUC    C^  C              G  C    --    CGAGGU 
       110       100        90        80          70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-148-P2_5p*

MirBase accessionNone
Sequence
0- AGGUUCUGUGAUACACUCCGACU -23
Get sequence
Mature sequence

Bta-Mir-148-P2_3p

MirBase accessionMIMAT0009238
Sequence
38- UCAGUGCAUGACAGAACUUGG -59
Get sequence
Validated targets TargetScanVert: bta-miR-152