MirGeneDB

MirGeneDB ID

Bta-Mir-142-v2

Family name MIR-142 (all species)
Seed UAGUGUU
Species Cow (Bos taurus)
MiRBase ID bta-mir-142
Paralogues Bta-Mir-142-v1  Bta-Mir-142-v3  Bta-Mir-142-v4 
Orthologues Cfa-Mir-142-v2  Cpo-Mir-142-v2  Dno-Mir-142-v2  Ete-Mir-142-v2  Hsa-Mir-142-v2  Mdo-Mir-142-v2  Mml-Mir-142-v2  Mmu-Mir-142-v2  Oan-Mir-142-v2  Ocu-Mir-142-v2  Rno-Mir-142-v2  Sha-Mir-142-v2  Sto-Mir-142-v2 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(bosTau8)
chr19: 9527318-9527376 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-142-v2)
Mir-142-v4 chr19: 9527316-9527378 [-] UCSC Ensembl
Mir-142-v1 chr19: 9527318-9527376 [-] UCSC Ensembl
Mir-142-v2 chr19: 9527318-9527376 [-] UCSC Ensembl
Mir-142-v3 chr19: 9527318-9527376 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCAGACGGACAGACAGACAGUGCAGUCACCCAUAAAGUAGAAAGCACUACUAACAGCACUGGAGGGUGUAGUGUUUCCUACUUUAUGGAUGAGUGUACUGUGGGCUUCGGAGACCACGC
Get precursor sequence
Structure
        10          20        30        40        50         
GCAGACGGACAGACAGA--|      G   C           A         UAACAGCA 
                   CAGUGCA UCA CCAUAAAGUAG AAGCACUAC        \
                   GUCAUGU AGU GGUAUUUCAUC UUUGUGAUG        C
CGCACCAGAGGCUUCGGGU^      G   A           C         UGGGAGGU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-142-v2_5p*

MirBase accessionMIMAT0003790
Sequence
0- CAUAAAGUAGAAAGCACUACUA -22
Get sequence
Validated targets TargetScanVert: bta-miR-142-5p
Mature sequence

Bta-Mir-142-v2_3p

MirBase accessionMIMAT0003791
Sequence
37- GUAGUGUUUCCUACUUUAUGGA -59
Get sequence
Validated targets TargetScanVert: bta-miR-142-3p