MirGeneDB

MirGeneDB ID

Bta-Mir-142-v1

Family name MIR-142 (all species)
Seed AUAAAGU
Species Cow (Bos taurus)
MiRBase ID bta-mir-142
Paralogues Bta-Mir-142-v2  Bta-Mir-142-v3  Bta-Mir-142-v4 
Orthologues Cfa-Mir-142-v1  Cpo-Mir-142-v1  Dno-Mir-142-v1  Ete-Mir-142-v1  Hsa-Mir-142-v1  Mdo-Mir-142-v1  Mml-Mir-142-v1  Mmu-Mir-142-v1  Oan-Mir-142-v1  Ocu-Mir-142-v1  Rno-Mir-142-v1  Sha-Mir-142-v1  Sto-Mir-142-v1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(bosTau8)
chr19: 9527318-9527376 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-142-v1)
Mir-142-v4 chr19: 9527316-9527378 [-] UCSC Ensembl
Mir-142-v1 chr19: 9527318-9527376 [-] UCSC Ensembl
Mir-142-v2 chr19: 9527318-9527376 [-] UCSC Ensembl
Mir-142-v3 chr19: 9527318-9527376 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GCAGACGGACAGACAGACAGUGCAGUCACCCAUAAAGUAGAAAGCACUACUAACAGCACUGGAGGGUGUAGUGUUUCCUACUUUAUGGAUGAGUGUACUGUGGGCUUCGGAGACCACGC
Get precursor sequence
Structure
        10          20        30        40        50         
GCAGACGGACAGACAGA--|      G   C           A         UAACAGCA 
                   CAGUGCA UCA CCAUAAAGUAG AAGCACUAC        \
                   GUCAUGU AGU GGUAUUUCAUC UUUGUGAUG        C
CGCACCAGAGGCUUCGGGU^      G   A           C         UGGGAGGU 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-142-v1_5p

MirBase accessionMIMAT0003790
Sequence
0- CAUAAAGUAGAAAGCACUACU -21
Get sequence
Validated targets TargetScanVert: bta-miR-142-5p
Star sequence

Bta-Mir-142-v1_3p*

MirBase accessionMIMAT0003791
Sequence
38- UAGUGUUUCCUACUUUAUGGA -59
Get sequence
Validated targets TargetScanVert: bta-miR-142-3p