MirGeneDB

MirGeneDB ID

Bta-Mir-140-v1

Family name MIR-140 (all species)
Seed CCACAGG
Species Cow (Bos taurus)
MiRBase ID bta-mir-140
Paralogues Bta-Mir-140-v2 
Orthologues Aca-Mir-140-v1  Ami-Mir-140-v1  Cfa-Mir-140-v1  Cli-Mir-140-v1  Cpi-Mir-140-v1  Cpo-Mir-140-v1  Dno-Mir-140-v1  Dre-Mir-140-v1  Ete-Mir-140-v1  Gga-Mir-140-v1  Hsa-Mir-140-v1  Mdo-Mir-140-v1  Mml-Mir-140-v1  Mmu-Mir-140-v1  Oan-Mir-140-v1  Ocu-Mir-140-v1  Rno-Mir-140-v1  Sha-Mir-140-v1  Sto-Mir-140-v1  Tgu-Mir-140-v1  Xtr-Mir-140-v1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(bosTau8)
chr18: 37088153-37088214 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-140-v1)
Mir-140-v1 chr18: 37088153-37088214 [+] UCSC Ensembl
Mir-140-v2 chr18: 37088153-37088214 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CCCGUGUGUGUCUGUCUCUCUGUGUCCUGCCAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGUUCUACCACAGGGUAGAACCACGGACAGGAUACCGGGGCACCCUCUGCAUCGAAGA
Get precursor sequence
Structure
        10          20         30        40        50        60
CCCGUGUGUGUCUGUCU--   U        -| A             A      GUUACGU 
                   CUC GUGUCCUG CC GUGGUUUUACCCU UGGUAG       C
                   GGG CAUAGGAC GG CACCAAGAUGGGA ACCAUC       A
AGAAGCUACGUCUCCCACG   C        A^ -             C      UUGUCGU 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Star sequence

Bta-Mir-140-v1_5p*

MirBase accessionNone
Sequence
0- CAGUGGUUUUACCCUAUGGUAG -22
Get sequence
Mature sequence

Bta-Mir-140-v1_3p

MirBase accessionMIMAT0003789
Sequence
40- ACCACAGGGUAGAACCACGGAC -62
Get sequence
Validated targets TargetScanVert: bta-miR-140