MirGeneDB

MirGeneDB ID

Bta-Mir-10-P3a

Family name MIR-10 (all species)
Seed CCCUGAG
Species Cow (Bos taurus)
MiRBase ID bta-mir-125b-1
Paralogues Bta-Mir-10-P1a-v1  Bta-Mir-10-P1a-v2  Bta-Mir-10-P1b-v1  Bta-Mir-10-P1b-v2  Bta-Mir-10-P2a  Bta-Mir-10-P2b  Bta-Mir-10-P2c  Bta-Mir-10-P3b  Bta-Mir-10-P3c 
Orthologues Aae-Mir-10-P3  Aca-Mir-10-P3a  Ami-Mir-10-P3a  Asu-Mir-10-P3  Bfl-Mir-10-P3  Bge-Mir-10-P3  Cfa-Mir-10-P3a  Cgi-Mir-10-P3  Cin-Mir-10-P3  Cli-Mir-10-P3a  Cpi-Mir-10-P3a  Cpo-Mir-10-P3a  Cte-Mir-10-P3  Dan-Mir-10-P3  Dme-Mir-10-P3  Dmo-Mir-10-P3  Dno-Mir-10-P3a  Dpu-Mir-10-P3  Dre-Mir-10-P3a1  Dre-Mir-10-P3a2  Ete-Mir-10-P3a  Gga-Mir-10-P3a  Hsa-Mir-10-P3a  Isc-Mir-10-P3  Lan-Mir-10-P3  Lgi-Mir-10-P3  Mdo-Mir-10-P3a  Mml-Mir-10-P3a  Mmu-Mir-10-P3a  Oan-Mir-10-P3a  Ocu-Mir-10-P3a  Pfl-Mir-10-P3  Pmi-Mir-10-P3  Rno-Mir-10-P3a  Sha-Mir-10-P3a  Sko-Mir-10-P3  Spu-Mir-10-P3  Sto-Mir-10-P3a  Tca-Mir-10-P3  Tgu-Mir-10-P3a  Xtr-Mir-10-P3a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Eumetazoa
Genome context
(bosTau8)
chr15: 33298827-33298888 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGAAAGAACAAUUUAGCGCGCGCCUCUCAAUCCCUGAGACCCUAACUUGUGAUGUUUACCGUUUAAAUCCACGGGUUAGGCUCUUGGGAGCUGCGAGUCGCGCCCUUGCAUCCUGGAAAUUU
Get precursor sequence
Structure
        10          20        30         40        50        60
AGAAAGAACAAUUUAGC--     C   U  A-|   U    C           AUGUUUAC 
                   GCGCG CUC CA  UCCC GAGA CCUAACUUGUG        C
                   CGCGC GAG GU  AGGG UUCU GGAUUGGGCAC        G
UUUAAAGGUCCUACGUUCC     U   C  CG^   -    C           CUAAAUUU 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-10-P3a_5p

MirBase accessionMIMAT0003539
Sequence
0- UCCCUGAGACCCUAACUUGUGA -22
Get sequence
Validated targets TargetScanVert: bta-miR-125b
Star sequence

Bta-Mir-10-P3a_3p*

MirBase accessionNone
Sequence
40- ACGGGUUAGGCUCUUGGGAGCU -62
Get sequence