MirGeneDB

MirGeneDB ID

Bta-Mir-10-P2a

Family name MIR-10 (all species)
Seed ACCCGUA
Species Cow (Bos taurus)
MiRBase ID bta-mir-100
Paralogues Bta-Mir-10-P1a-v1  Bta-Mir-10-P1a-v2  Bta-Mir-10-P1b-v1  Bta-Mir-10-P1b-v2  Bta-Mir-10-P2b  Bta-Mir-10-P2c  Bta-Mir-10-P3a  Bta-Mir-10-P3b  Bta-Mir-10-P3c 
Orthologues Aae-Mir-10-P2  Aca-Mir-10-P2a  Ami-Mir-10-P2a  Bfl-Mir-10-P2-v1  Bfl-Mir-10-P2-v2  Bge-Mir-10-P2  Cfa-Mir-10-P2a  Cgi-Mir-10-P2  Cin-Mir-10-P2  Cli-Mir-10-P2a  Cpi-Mir-10-P2a  Cpo-Mir-10-P2a  Cte-Mir-10-P2  Dan-Mir-10-P2  Dme-Mir-10-P2  Dmo-Mir-10-P2  Dno-Mir-10-P2a  Dpu-Mir-10-P2  Dre-Mir-10-P2a1  Dre-Mir-10-P2a2  Ete-Mir-10-P2a  Gga-Mir-10-P2a  Hsa-Mir-10-P2a  Isc-Mir-10-P2  Lan-Mir-10-P2  Lgi-Mir-10-P2  Mdo-Mir-10-P2a  Mml-Mir-10-P2a  Mmu-Mir-10-P2a  Oan-Mir-10-P2a  Ocu-Mir-10-P2a  Pfl-Mir-10-P2  Pmi-Mir-10-P2  Rno-Mir-10-P2a  Sha-Mir-10-P2a  Sko-Mir-10-P2  Sto-Mir-10-P2a  Tca-Mir-10-P2  Tgu-Mir-10-P2a3  Tgu-Mir-10-P2a4 
Node of Origin (locus) Vertebrata
Node of Origin (family) Eumetazoa
Genome context
(bosTau8)
chr15: 33353402-33353458 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-10-P2a)
Let-7-P1a chr15: 33347570-33347636 [-] UCSC Ensembl
Mir-10-P2a chr15: 33353402-33353458 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
CGAGAGAAGAUGCUAAGGCCUGUUGCCACAAACCCGUAGAUCCGAACUUGUGGUGGUAGUGCACACAAGCUUGUGUCUAUAGGUAUGUGUCUGUGGGCGAUCUCACAGACCACGGGC
Get precursor sequence
Structure
        10          20        30        40        50        
CGAGAGAAGAUGCUAAG--|  UG UGC    A   CG    UC   A      GUGGU 
                   GCC  U   CACA ACC  UAGA  CGA CUUGUG     \
                   CGG  G   GUGU UGG  AUCU  GUU GAACAC     A
CGGGCACCAGACACUCUAG^  GU UCU    A   AU    GU   C      ACGUG 
     110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Mir-10-P2a_5p

MirBase accessionMIMAT0009215
Sequence
0- AACCCGUAGAUCCGAACUUGUG -22
Get sequence
Validated targets TargetScanVert: bta-miR-100
Star sequence

Bta-Mir-10-P2a_3p*

MirBase accessionNone
Sequence
35- CAAGCUUGUGUCUAUAGGUAUG -57
Get sequence