MirGeneDB

MirGeneDB ID

Bta-Let-7-P1a

Family name LET-7 (all species)
Seed GAGGUAG
Species Cow (Bos taurus)
MiRBase ID bta-let-7a-2
Paralogues Bta-Let-7-P1b  Bta-Let-7-P1c  Bta-Let-7-P2a1  Bta-Let-7-P2a2  Bta-Let-7-P2a3  Bta-Let-7-P2b1  Bta-Let-7-P2b2  Bta-Let-7-P2b3  Bta-Let-7-P2c1  Bta-Let-7-P2c2  Bta-Let-7-P2c3 
Orthologues Aae-Let-7  Aca-Let-7-P1a  Ami-Let-7-P1a  Bge-Let-7  Cfa-Let-7-P1a  Cgi-Let-7  Cin-Let-7-P1  Cli-Let-7-P1a  Cpi-Let-7-P1a  Cpo-Let-7-P1a  Cte-Let-7  Dan-Let-7  Dme-Let-7  Dmo-Let-7  Dno-Let-7-P1a  Dpu-Let-7  Dre-Let-7-P1a1  Dre-Let-7-P1a2  Ete-Let-7-P1a  Gga-Let-7-P1a  Hme-Let-7  Hsa-Let-7-P1a  Isc-Let-7  Lan-Let-7  Lgi-Let-7  Mdo-Let-7-P1a  Mml-Let-7-P1a  Mmu-Let-7-P1a  Oan-Let-7-P1a  Ocu-Let-7-P1a  Pfl-Let-7  Pmi-Let-7  Rno-Let-7-P1a  Sha-Let-7-P1a  Sko-Let-7  Spu-Let-7  Sto-Let-7-P1a  Tca-Let-7  Tgu-Let-7-P1a 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(bosTau8)
chr15: 33347570-33347636 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Let-7-P1a)
Let-7-P1a chr15: 33347570-33347636 [-] UCSC Ensembl
Mir-10-P2a chr15: 33353402-33353458 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UCCAGCCAUUGUGACUGCAUGCUCCCAGGUUGAGGUAGUAGGUUGUAUAGUUUAGAAUUACAUCAAGGGAGAUAACUGUACAGCCUCCUAGCUUUCCUUGGGUCUUGCACAAAGCAACAUGCCAAGA
Get precursor sequence
Structure
        10        20           30        40        50        60   
UCCAGCCAUUGUGACUGCA   U---|     UU   G   U             UAGAAUUACA 
                   UGC    CCCAGG  GAG UAG AGGUUGUAUAGUU          \
                   ACG    GGGUUC  UUC AUC UCCGACAUGUCAA          U
AGAACCGUACAACGAAAC-   UUCU^     CU   G   C             UAGAGGGAAC 
     120       110        100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Cd Fe Bo Br Ce Co Co De He Hy Ir Ki La Lo No Op Or Pe Re Su Te
Mature sequence

Bta-Let-7-P1a_5p

MirBase accessionMIMAT0003844
Sequence
0- UGAGGUAGUAGGUUGUAUAGUU -22
Get sequence
Validated targets TargetScanVert: bta-let-7a-5p
Star sequence

Bta-Let-7-P1a_3p*

MirBase accessionNone
Sequence
45- CUGUACAGCCUCCUAGCUUUCC -67
Get sequence