MirGeneDB

MirGeneDB ID

Bge-Mir-9-o14

Family name MIR-9 (all species)
Seed CUUUGGU
Species Cockroach (Blattella germanica)
MiRBase ID
Paralogues Bge-Mir-9-o11  Bge-Mir-9-o12-v1  Bge-Mir-9-o12-v2  Bge-Mir-9-o13 
Orthologues Cgi-Mir-9-P14  Cin-Mir-9  Cte-Mir-9  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) B. germanica
Node of Origin (family) Bilateria
Genome context
(Bger_2.0)
KZ616519.1: 74858-74917 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
ACAUCACACGCAAGUUUGGCGCUGAUUUUUUCUUUGGUUAUCUAGCUGUAUGAGUGAAAUGAGCGUCAUAAAGCUAGGUUACCGAAGUUAAGAACAGCACCUCUUCAUCAAAAGGCGCGC
Get precursor sequence
Structure
        10          20        30        40        50         
ACAUCACACGCAAGUUU--| C    A    UU       U        G     GUGAA 
                   GG GCUG UUUU  CUUUGGU AUCUAGCU UAUGA     A
                   CC CGAC AGAA  GAAGCCA UGGAUCGA AUACU     U
CGCGCGGAAAACUACUUCU^ A    A    UU       U        A     GCGAG 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Mature sequence

Bge-Mir-9-o14_5p

MirBase accessionNone
Sequence
0- UCUUUGGUUAUCUAGCUGUAUGA -23
Get sequence
Star sequence

Bge-Mir-9-o14_3p*

MirBase accessionNone
Sequence
37- AUAAAGCUAGGUUACCGAAGUUA -60
Get sequence