MirGeneDB

MirGeneDB ID

Bge-Mir-9-o13

Family name MIR-9 (all species)
Seed CUUUGGU
Species Cockroach (Blattella germanica)
MiRBase ID
Paralogues Bge-Mir-9-o11  Bge-Mir-9-o12-v1  Bge-Mir-9-o12-v2  Bge-Mir-9-o14 
Orthologues Cgi-Mir-9-P13  Cin-Mir-9  Cte-Mir-9  Isc-Mir-9  Lan-Mir-9  Lgi-Mir-9  Pmi-Mir-9  Spu-Mir-9 
Node of Origin (locus) B. germanica
Node of Origin (family) Bilateria
Genome context
(Bger_2.0)
KZ614731.1: 672851-672910 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
GCACAACAGCAUUGGAGAACUGUGGUCCUGUCUUUGGUAUCCUAGCUGUAGGUUGUAUUAGCUGCUCCUAAAGCUAUUGUACCAAAGUAAGGAACAGUGUUCCAGUCUUCUCAGCCGGCG
Get precursor sequence
Structure
        10            20        30        40        50         
GCACAACAGCAUUGGAGA----|    GG    GU         CC     G    UUGUAU 
                      ACUGU  UCCU  CUUUGGUAU  UAGCU UAGG      U
                      UGACA  AGGA  GAAACCAUG  AUCGA AUCC      A
GCGGCCGACUCUUCUGACCUUG^    --    AU         UU     A    UCGUCG 
.       110       100          90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Mature sequence

Bge-Mir-9-o13_5p

MirBase accessionNone
Sequence
0- UCUUUGGUAUCCUAGCUGUAGG -22
Get sequence
Star sequence

Bge-Mir-9-o13_3p*

MirBase accessionNone
Sequence
38- UAAAGCUAUUGUACCAAAGUAA -60
Get sequence