MirGeneDB

MirGeneDB ID

Bge-Mir-3-o2a-v1

Family name MIR-3 (all species)
Seed CACUGGG
Species Cockroach (Blattella germanica)
MiRBase ID
Paralogues Bge-Mir-3-o2a-v2  Bge-Mir-3-o2b-v1  Bge-Mir-3-o2b-v2  Bge-Mir-3-o3-v1  Bge-Mir-3-o3-v2 
Orthologues Aae-Mir-3-P2a1  Aae-Mir-3-P2a2  Dan-Mir-3-P2  Dme-Mir-3-P2  Dmo-Mir-3-P2  Dpu-Mir-3  Hme-Mir-3-o2 
Node of Origin (locus) B. germanica
Node of Origin (family) Pancrustacea
Genome context
(Bger_2.0)
KZ618317.1: 56244-56302 [-] Ensembl
Precursor
(pre-Mir +30nt flank)
AAGAGAGGGUCAUACGCACUAGUGGUGGGUGAUAGUGACUCCCCAAGUGAUGCUACAUUCUGAACGUAUCACUGGGAAGACAUUAUCGUUAGCUACAAGUGAAAAGCAACAAACUAAAA
Get precursor sequence
Structure
        10          20        30        40        50         
AAGAGAGGGUCAUACGC--|  A     GG         A  C    A      CUACAU 
                   ACU GUGGU  GUGAUAGUG CU CCCA GUGAUG      U
                   UGA CAUCG  UGCUAUUAC GA GGGU CACUAU      C
AAAAUCAAACAACGAAAAG^  A     AU         A  A    -      GCAAGU 
       110       100        90        80         70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Star sequence

Bge-Mir-3-o2a-v1_5p*

MirBase accessionNone
Sequence
0- GAUAGUGACUCCCCAAGUGAUG -22
Get sequence
Mature sequence

Bge-Mir-3-o2a-v1_3p

MirBase accessionNone
Sequence
38- UCACUGGGAAGACAUUAUCGU -59
Get sequence