MirGeneDB

MirGeneDB ID

Bge-Mir-2-o68-v1

Family name MIR-2 (all species)
Seed AUCACAG
Species Cockroach (Blattella germanica)
MiRBase ID
Paralogues Bge-Mir-2-o66-v1  Bge-Mir-2-o66-v2  Bge-Mir-2-o67-v1  Bge-Mir-2-o67-v2  Bge-Mir-2-o68-v2  Bge-Mir-2-o69  Bge-Mir-2-o70  Bge-Mir-2-P7 
Orthologues
Node of Origin (locus) B. germanica
Node of Origin (family) Protostomia
Genome context
(Bger_2.0)
KZ615136.1: 496135-496195 [+] Ensembl
Precursor
(pre-Mir +30nt flank)
GUUGUCACCGAGAAGUUGAGCAGUGUUCUGGCAUCAAAUCUGGUUUGUCAUAGAUUGCUUGAGUCCACUAUCACAGCCAGCUUUGAUGAGCAGAAAGUUGUCUCUAUAAUCUGUUGGAUCA
Get precursor sequence
Structure
        10         20        30         40        50        60
GUUGUCACCGAGAAGUUGA-    UG     G-|      U      U  C    AUUGCU 
                    GCAG  UUCUG  CAUCAAA CUGGUU GU AUAG      U
                    UGUU  AAGAC  GUAGUUU GACCGA CA UAUC      G
ACUAGGUUGUCUAAUAUCUC    GA     GA^      C      -  C    ACCUGA 
 .       110       100        90        80         70
Deep sequencing
Go to detailed chart
CommentIt is not clear either from phylogenetic or syntenic information how many Mir-2 genes were present in the last common ancestor of protostomes and thus these multiple paralogues in invertebrates other than Drosophila are classified here as orphans pending further data and analysis.
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Ad Ad Ny Ny Ny Ny Ny Ny Ny Ny Ov Co Co Em Em Em Em Em Em Em Em Em Em No No
Star sequence

Bge-Mir-2-o68-v1_5p*

MirBase accessionNone
Sequence
0- GCAUCAAAUCUGGUUUGUCAUAGA -24
Get sequence
Mature sequence

Bge-Mir-2-o68-v1_3p

MirBase accessionNone
Sequence
38- UAUCACAGCCAGCUUUGAUGAGC -61
Get sequence