MirGeneDB

MirGeneDB ID

Ami-Mir-29-P1b

Family name MIR-29 (all species)
Seed AGCACCA
Species American alligator (Alligator mississippiensis)
MiRBase ID ami-mir-29a-2
Paralogues Ami-Mir-29-P1a  Ami-Mir-29-P2a-v1  Ami-Mir-29-P2a-v2  Ami-Mir-29-P2b-v1  Ami-Mir-29-P2b-v2 
Orthologues Aca-Mir-29-P1b  Asu-Mir-29-P1  Bfl-Mir-29-P1  Bta-Mir-29-P1b  Cbr-Mir-29-P1  Cel-Mir-29-P1  Cfa-Mir-29-P1b3  Cfa-Mir-29-P1b4  Cgi-Mir-29-P1  Cin-Mir-29-P1  Cli-Mir-29-P1b  Cpi-Mir-29-P1b  Cpo-Mir-29-P1b  Cte-Mir-29-P1  Dno-Mir-29-P1b  Ete-Mir-29-P1b  Gga-Mir-29-P1b  Hsa-Mir-29-P1b  Isc-Mir-29-P1  Lgi-Mir-29-P1  Mdo-Mir-29-P1b  Mml-Mir-29-P1b  Mmu-Mir-29-P1b  Oan-Mir-29-P1b  Ocu-Mir-29-P1b  Pfl-Mir-29-P1  Pmi-Mir-29-P1  Rno-Mir-29-P1b1  Rno-Mir-29-P1b2  Sha-Mir-29-P1b  Sko-Mir-29-P1  Spu-Mir-29-P1  Sto-Mir-29-P1b  Tgu-Mir-29-P1b  Xtr-Mir-29-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(allMis1)
JH733643: 116571-116630 [+] UCSC
Clustered MiRNAs
(< 10kb from Mir-29-P1b)
Mir-29-P2b-v1 JH733643: 115693-115756 [+] UCSC
Mir-29-P2b-v2 JH733643: 115694-115755 [+] UCSC
Mir-29-P1b JH733643: 116571-116630 [+] UCSC
Precursor
(pre-Mir +30nt flank)
GAACUGGAAAAAAGUCUCUUACACAGGCUGACCGAUUUCUCUUGGUGUUCAGAGUCUCAGUGUUUGUCUAGCACCAUUUGAAAUCGGUUAUGAUGUAGGGGGAAAAGCAACAGUAAUUGG
Get precursor sequence
Structure
        10            20         30        40        50          
GAACUGGAAAAAAGUCU----      -| GGC           UCU       C   GUCUCA 
                     CUUACA CA   UGACCGAUUUC   UGGUGUU AGA      \
                     GGAUGU GU   AUUGGCUAAAG   ACCACGA UCU      G
GGUUAAUGACAACGAAAAGGG      A^ ---           UUU       -   GUUUGU 
.       110       100           90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Ami-Mir-29-P1b_5p*

MirBase accessionMIMAT0038073
Sequence
0- ACCGAUUUCUCUUGGUGUUCAGA -23
Get sequence
Mature sequence

Ami-Mir-29-P1b_3p

MirBase accessionMIMAT0038072
Sequence
38- UAGCACCAUUUGAAAUCGGUUA -60
Get sequence