MirGeneDB

MirGeneDB ID

Ami-Mir-23-P1

Family name MIR-23 (all species)
Seed UCACAUU
Species American alligator (Alligator mississippiensis)
MiRBase ID ami-mir-23a
Paralogues Ami-Mir-23-P2 
Orthologues Aca-Mir-23-P1  Bta-Mir-23-P1  Cfa-Mir-23-P1  Cpi-Mir-23-P1  Cpo-Mir-23-P1  Dno-Mir-23-P1  Dre-Mir-23-P1  Ete-Mir-23-P1  Hsa-Mir-23-P1  Mdo-Mir-23-P1  Mml-Mir-23-P1  Mmu-Mir-23-P1  Oan-Mir-23-P1  Rno-Mir-23-P1  Sha-Mir-23-P1  Sto-Mir-23-o1  Sto-Mir-23-P1  Xtr-Mir-23-P1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(allMis1)
JH732793: 220314-220375 [+] UCSC
Clustered MiRNAs
(< 10kb from Mir-23-P1)
Mir-23-P1 JH732793: 220314-220375 [+] UCSC
Mir-27-P1 JH732793: 220504-220566 [+] UCSC
Mir-24-P1 JH732793: 220779-220839 [+] UCSC
Precursor
(pre-Mir +30nt flank)
CACAGCCCUCUCUCCCUGCCACAGCCAGCUGGGGUUCCUGGUGAUGCGAUUUUUUUACCCACUGCCCAAAAUCACAUUGCCAGGGAUUUCCAACUGGCUGCGAGCCCCAGCGCCAAGGAGAC
Get precursor sequence
Structure
        10        20         30         40        50        60
CACAGCCCUCUCUCCCUGCCA-       C   -|        UG   C     UUUUACC 
                      CAGCCAG UGG GGUUCCUGG  AUG GAUUU       C
                      GUCGGUC ACC UUAGGGACC  UAC CUAAA       A
CAGAGGAACCGCGACCCCGAGC       A   U^        GU   A     ACCCGUC 
120       110       100        90        80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17)
Tissue expression
 +
To
Star sequence

Ami-Mir-23-P1_5p* (predicted)

MirBase accessionNone
Sequence
0- GGGGUUCCUGGUGAUGCGAUUU -22
Get sequence
Mature sequence

Ami-Mir-23-P1_3p

MirBase accessionMIMAT0038058
Sequence
40- AUCACAUUGCCAGGGAUUUCCA -62
Get sequence