MirGeneDB

MirGeneDB ID

Ami-Mir-219-P1

Family name MIR-219 (all species)
Seed GAUUGUC
Species American alligator (Alligator mississippiensis)
MiRBase ID ami-mir-219a
Paralogues Ami-Mir-219-P2 
Orthologues Aae-Mir-219  Aca-Mir-219-P1  Bfl-Mir-219  Bge-Mir-219  Bta-Mir-219-P1  Cfa-Mir-219-P1  Cgi-Mir-219  Cin-Mir-219  Cpi-Mir-219-P1  Cpo-Mir-219-P1  Cte-Mir-219  Dan-Mir-219  Dme-Mir-219  Dmo-Mir-219  Dno-Mir-219-P1  Dpu-Mir-219  Dre-Mir-219-P1a  Ete-Mir-219-P1  Hsa-Mir-219-P1  Isc-Mir-219  Lan-Mir-219  Mdo-Mir-219-P1  Mml-Mir-219-P1  Mmu-Mir-219-P1  Mmu-Mir-219-P1-as  Ocu-Mir-219-P1  Pfl-Mir-219  Pmi-Mir-219  Rno-Mir-219-P1  Sha-Mir-219-P1  Sko-Mir-219  Spu-Mir-219  Sto-Mir-219-P1-v1  Sto-Mir-219-P1-v2  Tca-Mir-219 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(allMis1)
JH736116: 54074-54129 [+] UCSC
Precursor
(pre-Mir +30nt flank)
CACGCCUCCUCAUAUGUGAGCGCCGGGUCCUGAUUGUCCAAACGCAAUUCUUGUGUCUGCCCCAAGAAUUGAGUGUGGACGUCGGGAGCCGCCGUUCCCCACCGACGCCCGGCGGA
Get precursor sequence
Structure
        10          20        30        40        50        
CACGCCUCCUCAUAUGU--|    C   G       U     A  G         UGUC 
                   GAGCG CGG UCCUGAU GUCCA AC CAAUUCUUG    \
                   CUUGC GCC AGGGCUG CAGGU UG GUUAAGAAC    U
AGGCGGCCCGCAGCCACCC^    C   G       -     G  A         CCCG 
    110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14), CNNC at 3p(+17), UGUG in loop
Tissue expression
 +
To
Mature sequence

Ami-Mir-219-P1_5p

MirBase accessionMIMAT0038248
Sequence
0- UGAUUGUCCAAACGCAAUUCUUG -23
Get sequence
Co-mature sequence

Ami-Mir-219-P1_3p

MirBase accessionMIMAT0038249
Sequence
34- AGAAUUGAGUGUGGACGUCGGG -56
Get sequence