MirGeneDB

MirGeneDB ID

Ami-Mir-140-v1

Family name MIR-140 (all species)
Seed CCACAGG
Species American alligator (Alligator mississippiensis)
MiRBase ID ami-mir-140
Paralogues Ami-Mir-140-v2 
Orthologues Aca-Mir-140-v1  Bta-Mir-140-v1  Cfa-Mir-140-v1  Cli-Mir-140-v1  Cpi-Mir-140-v1  Cpo-Mir-140-v1  Dno-Mir-140-v1  Dre-Mir-140-v1  Ete-Mir-140-v1  Gga-Mir-140-v1  Hsa-Mir-140-v1  Mdo-Mir-140-v1  Mml-Mir-140-v1  Mmu-Mir-140-v1  Oan-Mir-140-v1  Ocu-Mir-140-v1  Rno-Mir-140-v1  Sha-Mir-140-v1  Sto-Mir-140-v1  Tgu-Mir-140-v1  Xtr-Mir-140-v1 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(allMis1)
JH731391: 1204640-1204701 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-140-v1)
Mir-140-v1 JH731391: 1204640-1204701 [-] UCSC
Mir-140-v2 JH731391: 1204640-1204701 [-] UCSC
Precursor
(pre-Mir +30nt flank)
GUGGGCUUCUGCUCUCUCUCUGUGUCCUGCCAGUGGUUUUACCCUAUGGUAGGUUACGUCAUGCUGUUCUACCACAGGGUAGAACCACGGACGGGAUACCGGGGCGCGCGCUGCGUCGGAGG
Get precursor sequence
Structure
        10          20         30        40        50        60
GUGGGCUUCUGCUCUCU--   U        -| A             A      GUUACGU 
                   CUC GUGUCCUG CC GUGGUUUUACCCU UGGUAG       C
                   GGG CAUAGGGC GG CACCAAGAUGGGA ACCAUC       A
GGAGGCUGCGUCGCGCGCG   C        A^ -             C      UUGUCGU 
120       110       100        90         80        70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsNo
Tissue expression
 +
To
Star sequence

Ami-Mir-140-v1_5p*

MirBase accessionMIMAT0038160
Sequence
0- CAGUGGUUUUACCCUAUGGUAG -22
Get sequence
Mature sequence

Ami-Mir-140-v1_3p

MirBase accessionMIMAT0038161
Sequence
40- ACCACAGGGUAGAACCACGGAC -62
Get sequence