MirGeneDB

MirGeneDB ID

Ami-Mir-130-P3b

Family name MIR-130 (all species)
Seed AGUGCAA
Species American alligator (Alligator mississippiensis)
MiRBase ID ami-mir-130b
Paralogues Ami-Mir-130-P1a  Ami-Mir-130-P2a  Ami-Mir-130-P2b  Ami-Mir-130-P3a  Ami-Mir-130-P4b 
Orthologues Aca-Mir-130-P3b  Cli-Mir-130-P3b  Cpi-Mir-130-P3b  Dre-Mir-130-P3b1  Dre-Mir-130-P3b2  Gga-Mir-130-P3b  Oan-Mir-130-P3b  Sto-Mir-130-P3b  Tgu-Mir-130-P3b  Xtr-Mir-130-P3b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(allMis1)
JH735238: 11811-11869 [-] UCSC
Clustered MiRNAs
(< 10kb from Mir-130-P3b)
Mir-130-P4b JH735238: 3935-3998 [-] UCSC
Mir-130-P2b JH735238: 10614-10672 [-] UCSC
Mir-130-P3b JH735238: 11811-11869 [-] UCSC
Precursor
(pre-Mir +30nt flank)
AAAAGUCUGUGAAGUAUGCUGUUGUCCAGAGCCCUUUUUCUGUUGUACUACUGGCAAUUAUGAUGAGCAGUGCAAUAUUAAAAGGGCAUUGGCUGGCAGAAACAUGACCCCUUUUAGCA
Get precursor sequence
Structure
        10          20        30        40        50         
AAAAGUCUGUGAAGUAUG--|     U    A        UC         A  GGCAAU 
                    CUGUUG CCAG GCCCUUUU  UGUUGUACU CU      \
                    GACGGU GGUU CGGGAAAA  AUAACGUGA GA      U
ACGAUUUUCCCCAGUACAAA^     C    A        UU         C  GUAGUA 
       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
To
Star sequence

Ami-Mir-130-P3b_5p*

MirBase accessionMIMAT0038141
Sequence
0- GCCCUUUUUCUGUUGUACUACU -22
Get sequence
Mature sequence

Ami-Mir-130-P3b_3p

MirBase accessionMIMAT0038142
Sequence
37- CAGUGCAAUAUUAAAAGGGCAU -59
Get sequence