MirGeneDB

MirGeneDB ID

Aca-Mir-92-P1b

Family name MIR-92 (all species)
Seed AUUGCAC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-92a-2
Paralogues Aca-Mir-92-P1a  Aca-Mir-92-P2a  Aca-Mir-92-P2b 
Orthologues Asu-Mir-92  Bfl-Mir-92-o1  Bta-Mir-92-P1b  Cel-Mir-92  Cfa-Mir-92-P1b  Cli-Mir-92-P1b  Cpi-Mir-92-P1b  Cpo-Mir-92-P1b  Dno-Mir-92-P1b  Ete-Mir-92-P1b  Gga-Mir-92-P1b  Hsa-Mir-92-P1b  Isc-Mir-92  Mdo-Mir-92-P1b  Mml-Mir-92-P1b  Mmu-Mir-92-P1b  Oan-Mir-92-P1b  Ocu-Mir-92-P1b  Rno-Mir-92-P1b  Sha-Mir-92-P1b  Sto-Mir-92-P1b  Tgu-Mir-92-P1b  Xtr-Mir-92-P1b 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
GL344214.1: 24446-24508 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-92-P1b)
Mir-17-P2b GL344214.1: 22479-22543 [+] UCSC Ensembl
Mir-17-P3b GL344214.1: 24042-24104 [+] UCSC Ensembl
Mir-92-P1b GL344214.1: 24446-24508 [+] UCSC Ensembl
Mir-92-P2b GL344214.1: 24606-24670 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
GGCCUUUGGAGGAGGAACUGACUUCUCCCUGGGUUGGGAUUUGUUGCAUUACUUGUGGGUUCCCUGAACAGUAUUGCACUUGUCCCGGCCUGUGGAGGAGGAGCGGAGACCUUCGCCACCAAG
Get precursor sequence
Structure
        10        20          30        40        50        60 
GGCCUUUGGAGGAGGAACUGA--|      C           UU  U   U    UGUGGGU 
                       CUUCUCC UGGGUUGGGAU  GU GCA UACU       U
                       GAGGAGG GUCCGGCCCUG  CA CGU AUGA       C
GAACCACCGCUUCCAGAGGCGAG^      U           UU  -   U    CAAGUCC 
 120       110       100        90        80         70
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17), UGUG in loop
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-92-P1b_5p*

MirBase accessionNone
Sequence
0- GGGUUGGGAUUUGUUGCAUUACU -23
Get sequence
Mature sequence

Aca-Mir-92-P1b_3p

MirBase accessionMIMAT0021993
Sequence
41- UAUUGCACUUGUCCCGGCCUGU -63
Get sequence