MirGeneDB

MirGeneDB ID

Aca-Mir-7-P3

Family name MIR-7 (all species)
Seed GGAAGAC
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-7-1
Paralogues Aca-Mir-7-P1  Aca-Mir-7-P2 
Orthologues Aae-Mir-7  Ami-Mir-7-P3  Asu-Mir-7  Bfl-Mir-7  Bge-Mir-7  Bta-Mir-7-P3  Cfa-Mir-7-P3  Cgi-Mir-7  Cin-Mir-7  Cli-Mir-7-P3  Cpi-Mir-7-P3  Cpo-Mir-7-P3  Cte-Mir-7  Dan-Mir-7  Dme-Mir-7  Dmo-Mir-7  Dno-Mir-7-P3  Ete-Mir-7-P3  Gga-Mir-7-P3  Hme-Mir-7  Hsa-Mir-7-P3  Isc-Mir-7  Lan-Mir-7  Lgi-Mir-7  Mdo-Mir-7-P3  Mml-Mir-7-P3  Mmu-Mir-7-P3  Ocu-Mir-7-P3  Pfl-Mir-7  Pmi-Mir-7  Rno-Mir-7-P3  Sha-Mir-7-P3  Sko-Mir-7  Spu-Mir-7  Sto-Mir-7-P3  Tgu-Mir-7-P3 
Node of Origin (locus) Vertebrata
Node of Origin (family) Bilateria
Genome context
(anoCar2)
G889P69796FC23: 216-278 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
ACAAGAAGACCCUUGUGGCUGGUUUCUGGGUGGAAGACUAGUGAUUUUGUUGUUCUGACUUAUAAUUUAGACAACAAAUCGUAGCCUGCCGCCCAGCGACCACAGCCGAGCACCCUUUGGCAU
Get precursor sequence
Structure
        10          20        30        40        50        60  
ACAAGAAGACCCUUGUGGC--|    U        A  A   G      U      CUGACUU 
                     UGGUU CUGGGUGG AG CUA UGAUUU GUUGUU       \
                     ACCAG GACCCGCC UC GAU GCUAAA CAACAG       A
UACGGUUUCCCACGAGCCGAC^    C        G  C   -      -      AUUUAAU 
 120       110       100        90         80         70
Deep sequencing
Go to detailed chart
CommentNot in assembly but in trace archive.
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-7-P3_5p

MirBase accessionMIMAT0021983
Sequence
0- UGGAAGACUAGUGAUUUUGUUGUU -24
Get sequence
Star sequence

Aca-Mir-7-P3_3p*

MirBase accessionMIMAT0021984
Sequence
41- CAACAAAUCGUAGCCUGCCGCC -63
Get sequence