MirGeneDB

MirGeneDB ID

Aca-Mir-5464

Family name MIR-5464 (all species)
Seed UUUGCCU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-5464
Paralogues
Orthologues
Node of Origin (locus) A. carolinensis
Node of Origin (family) A. carolinensis
Genome context
(anoCar2)
GL343194.1: 9704613-9704667 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AGUUUCUUUUUUAUGAUGGCCUCUAUCUUGCCGUUCUUACCGAGGCAAUAAAGUAGAUGAGAUUUUUGCCUAAGUAAGGACUUCAGGAUUAGGCCCAAUGGACUCUCAGCUGGGC
Get precursor sequence
Structure
        10           20        30        40        50       
AGUUUCUUUUUUAUGAU---|    CU      CC        CG      UAAAGUAG 
                    GGCCU  AUCUUG  GUUCUUAC  AGGCAA        \
                    CCGGA  UAGGAC  CAGGAAUG  UCCGUU        A
CGGGUCGACUCUCAGGUAAC^    U-      UU        AA      UUUAGAGU 
   110       100        90         80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUG at 5p(-14)
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-5464_5p*

MirBase accessionMIMAT0022096
Sequence
0- CCGUUCUUACCGAGGCAAUAAA -22
Get sequence
Mature sequence

Aca-Mir-5464_3p

MirBase accessionMIMAT0022097
Sequence
33- UUUUGCCUAAGUAAGGACUUCA -55
Get sequence