MirGeneDB

MirGeneDB ID

Aca-Mir-430-P2

Family name MIR-430 (all species)
Seed AAGUGCU
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-302b
Paralogues Aca-Mir-430-P1 
Orthologues Ami-Mir-430-P2  Bta-Mir-430-P2  Cfa-Mir-430-P2  Cli-Mir-430-P2  Cpi-Mir-430-P2  Cpo-Mir-430-P2  Dno-Mir-430-P2  Dre-Mir-430-o2a1  Dre-Mir-430-o2a2  Dre-Mir-430-o2a3  Dre-Mir-430-o2a4  Dre-Mir-430-o2a5  Dre-Mir-430-o2a6  Dre-Mir-430-o2a7  Dre-Mir-430-o2a8  Dre-Mir-430-o2a9  Dre-Mir-430-o2a10  Dre-Mir-430-o2a11  Dre-Mir-430-o2a12  Dre-Mir-430-o2a13  Dre-Mir-430-o2a14  Dre-Mir-430-o2b  Dre-Mir-430-o2c1  Dre-Mir-430-o2c2  Dre-Mir-430-o2c3  Dre-Mir-430-o2d1  Dre-Mir-430-o2d2  Ete-Mir-430-P2  Gga-Mir-430-P2  Hsa-Mir-430-P2  Mdo-Mir-430-P2  Mml-Mir-430-P2  Mmu-Mir-430-P2  Oan-Mir-430-P2  Ocu-Mir-430-P2  Rno-Mir-430-P2  Sha-Mir-430-P2  Tgu-Mir-430-P2  Xtr-Mir-430-P2 
Node of Origin (locus) Tetrapoda
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
5: 142962983-142963042 [+] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-430-P2)
Mir-430-P2 5: 142962983-142963042 [+] UCSC Ensembl
Mir-92-P2a 5: 142964152-142964211 [+] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
AUAGGGGAAUCUGCAGUAUGGACUGCUUCUACUUUAACAUGGAGGUGCUUUCUGUGCAUAUAAAAAGUAAGUGCUUCCAUGUUUUAGUAGAGGUGAAUCCUGAACUCACUCUCAGUUUAC
Get precursor sequence
Structure
        10         20         30        40        50         
AUAGGGGAAUCUGCAGUAU-   CU-|        UU          UG   U  GUGCA 
                    GGA   GCUUCUACU  AACAUGGAGG  CUU CU     U
                    CCU   UGGAGAUGA  UUGUACCUUC  GAA GA     A
CAUUUGACUCUCACUCAAGU   AAG^        UU          GU   U  AAAAU 
.       110       100        90        80        70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsUGUG in loop
Tissue expression
 +
Sk To Wh
Star sequence

Aca-Mir-430-P2_5p*

MirBase accessionNone
Sequence
0- ACUUUAACAUGGAGGUGCUUUCU -23
Get sequence
Mature sequence

Aca-Mir-430-P2_3p

MirBase accessionMIMAT0021919
Sequence
37- UAAGUGCUUCCAUGUUUUAGUAG -60
Get sequence