MirGeneDB

MirGeneDB ID

Aca-Mir-30-P1c

Family name MIR-30 (all species)
Seed GUAAACA
Species Green anole lizard (Anolis carolinensis)
MiRBase ID aca-mir-30d
Paralogues Aca-Mir-30-P1a  Aca-Mir-30-P1b  Aca-Mir-30-P2a  Aca-Mir-30-P2b  Aca-Mir-30-P2c 
Orthologues Ami-Mir-30-P1c  Bta-Mir-30-P1c  Cfa-Mir-30-P1c  Cli-Mir-30-P1c  Cpi-Mir-30-P1c  Cpo-Mir-30-P1c  Dno-Mir-30-P1c  Dre-Mir-30-P1c  Ete-Mir-30-P1c  Gga-Mir-30-P1c  Hsa-Mir-30-P1c  Mdo-Mir-30-P1c  Mml-Mir-30-P1c  Mmu-Mir-30-P1c  Oan-Mir-30-P1c  Ocu-Mir-30-P1c  Rno-Mir-30-P1c  Sha-Mir-30-P1c  Sto-Mir-30-P1c  Tgu-Mir-30-P1c  Xtr-Mir-30-P1c 
Node of Origin (locus) Vertebrata
Node of Origin (family) Vertebrata
Genome context
(anoCar2)
4: 1751122-1751178 [-] UCSC Ensembl
Clustered MiRNAs
(< 10kb from Mir-30-P1c)
Mir-30-P2c 4: 1747987-1748046 [-] UCSC Ensembl
Mir-30-P1c 4: 1751122-1751178 [-] UCSC Ensembl
Precursor
(pre-Mir +30nt flank)
UUCUUUCCCAGAUGCACAGUAGUCUGUUGUUGUAAACAUCCCCGACUGGAAGCUGUAAAUUUCAGCUUUCAGUCAGAUGUUUGCUGCCACCGGCUAUUCAUAAACAACGCUGGAAGA
Get precursor sequence
Structure
        10          20        30        40        50         
UUCUUUCCCAGAUGCAC--|      U  U  U         CCC           GUAA 
                   AGUAGUC GU GU GUAAACAUC   GACUGGAAGCU    \
                   UUAUCGG CA CG CGUUUGUAG   CUGACUUUCGA    A
AGAAGGUCGCAACAAAUAC^      C  C  U         A--           CUUU 
     110       100        90        80          70        60
Deep sequencing
Go to detailed chart
3' NTU No
MotifsCNNC at 3p(+17)
Tissue expression
 +
Sk To Wh
Mature sequence

Aca-Mir-30-P1c_5p

MirBase accessionMIMAT0021926
Sequence
0- UGUAAACAUCCCCGACUGGAAGCU -24
Get sequence
Star sequence

Aca-Mir-30-P1c_3p*

MirBase accessionMIMAT0021927
Sequence
35- CUUUCAGUCAGAUGUUUGCUGC -57
Get sequence